ID: 1072360471

View in Genome Browser
Species Human (GRCh38)
Location 10:94654180-94654202
Sequence ACAGCTCTTGGACTGTTACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072360468_1072360471 12 Left 1072360468 10:94654145-94654167 CCATCTTCTGTAGACAATTACTC No data
Right 1072360471 10:94654180-94654202 ACAGCTCTTGGACTGTTACTCGG No data
1072360467_1072360471 16 Left 1072360467 10:94654141-94654163 CCTGCCATCTTCTGTAGACAATT No data
Right 1072360471 10:94654180-94654202 ACAGCTCTTGGACTGTTACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072360471 Original CRISPR ACAGCTCTTGGACTGTTACT CGG Intergenic
No off target data available for this crispr