ID: 1072360472

View in Genome Browser
Species Human (GRCh38)
Location 10:94654186-94654208
Sequence CTTGGACTGTTACTCGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072360470_1072360472 -6 Left 1072360470 10:94654169-94654191 CCTTTTGAGAGACAGCTCTTGGA 0: 4
1: 196
2: 185
3: 171
4: 383
Right 1072360472 10:94654186-94654208 CTTGGACTGTTACTCGGCTTTGG No data
1072360468_1072360472 18 Left 1072360468 10:94654145-94654167 CCATCTTCTGTAGACAATTACTC No data
Right 1072360472 10:94654186-94654208 CTTGGACTGTTACTCGGCTTTGG No data
1072360467_1072360472 22 Left 1072360467 10:94654141-94654163 CCTGCCATCTTCTGTAGACAATT No data
Right 1072360472 10:94654186-94654208 CTTGGACTGTTACTCGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072360472 Original CRISPR CTTGGACTGTTACTCGGCTT TGG Intergenic
No off target data available for this crispr