ID: 1072360472 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:94654186-94654208 |
| Sequence | CTTGGACTGTTACTCGGCTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072360470_1072360472 | -6 | Left | 1072360470 | 10:94654169-94654191 | CCTTTTGAGAGACAGCTCTTGGA | 0: 4 1: 196 2: 185 3: 171 4: 383 |
||
| Right | 1072360472 | 10:94654186-94654208 | CTTGGACTGTTACTCGGCTTTGG | No data | ||||
| 1072360468_1072360472 | 18 | Left | 1072360468 | 10:94654145-94654167 | CCATCTTCTGTAGACAATTACTC | No data | ||
| Right | 1072360472 | 10:94654186-94654208 | CTTGGACTGTTACTCGGCTTTGG | No data | ||||
| 1072360467_1072360472 | 22 | Left | 1072360467 | 10:94654141-94654163 | CCTGCCATCTTCTGTAGACAATT | No data | ||
| Right | 1072360472 | 10:94654186-94654208 | CTTGGACTGTTACTCGGCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072360472 | Original CRISPR | CTTGGACTGTTACTCGGCTT TGG | Intergenic | ||
| No off target data available for this crispr | |||||