ID: 1072370899 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:94765647-94765669 |
| Sequence | GAGCTGCTGCAGGGGATCCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072370886_1072370899 | 30 | Left | 1072370886 | 10:94765594-94765616 | CCATTCAAGAGAGTGATTGAAAG | 0: 9 1: 24 2: 22 3: 31 4: 171 |
||
| Right | 1072370899 | 10:94765647-94765669 | GAGCTGCTGCAGGGGATCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072370899 | Original CRISPR | GAGCTGCTGCAGGGGATCCA GGG | Intronic | ||
| No off target data available for this crispr | |||||