ID: 1072370899

View in Genome Browser
Species Human (GRCh38)
Location 10:94765647-94765669
Sequence GAGCTGCTGCAGGGGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072370886_1072370899 30 Left 1072370886 10:94765594-94765616 CCATTCAAGAGAGTGATTGAAAG 0: 9
1: 24
2: 22
3: 31
4: 171
Right 1072370899 10:94765647-94765669 GAGCTGCTGCAGGGGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072370899 Original CRISPR GAGCTGCTGCAGGGGATCCA GGG Intronic
No off target data available for this crispr