ID: 1072373100

View in Genome Browser
Species Human (GRCh38)
Location 10:94785933-94785955
Sequence TGGCATTTACATAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072373100_1072373105 0 Left 1072373100 10:94785933-94785955 CCCTGCCCACTATGTAAATGCCA No data
Right 1072373105 10:94785956-94785978 CACCTGATTGAGCCAATCTTTGG No data
1072373100_1072373106 1 Left 1072373100 10:94785933-94785955 CCCTGCCCACTATGTAAATGCCA No data
Right 1072373106 10:94785957-94785979 ACCTGATTGAGCCAATCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072373100 Original CRISPR TGGCATTTACATAGTGGGCA GGG (reversed) Intronic
No off target data available for this crispr