ID: 1072374911

View in Genome Browser
Species Human (GRCh38)
Location 10:94804361-94804383
Sequence CAGTTGGTCTGGAGGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072374911_1072374920 27 Left 1072374911 10:94804361-94804383 CCTACCTTCCTCCAGACCAACTG 0: 1
1: 0
2: 0
3: 23
4: 253
Right 1072374920 10:94804411-94804433 ATCTGCGTGGCCATGATGCCAGG No data
1072374911_1072374919 14 Left 1072374911 10:94804361-94804383 CCTACCTTCCTCCAGACCAACTG 0: 1
1: 0
2: 0
3: 23
4: 253
Right 1072374919 10:94804398-94804420 CTGAGACTAAAATATCTGCGTGG No data
1072374911_1072374915 -10 Left 1072374911 10:94804361-94804383 CCTACCTTCCTCCAGACCAACTG 0: 1
1: 0
2: 0
3: 23
4: 253
Right 1072374915 10:94804374-94804396 AGACCAACTGCTCCGATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072374911 Original CRISPR CAGTTGGTCTGGAGGAAGGT AGG (reversed) Intronic
900131048 1:1087400-1087422 CAGTGGCTCTGGGGCAAGGTGGG + Intronic
901412389 1:9093495-9093517 CTGATGGTCTGTAGTAAGGTTGG - Intergenic
901516630 1:9751674-9751696 CAGTTGCTCTGGACAAAGGGAGG + Exonic
903265076 1:22153362-22153384 CTCTTGGGCTGGTGGAAGGTAGG + Intergenic
903919513 1:26789296-26789318 CAGGAGGCCTGGAGGAAGGGAGG - Intronic
904299320 1:29543911-29543933 AAGTAGGCCTGGAGCAAGGTTGG - Intergenic
905731659 1:40302802-40302824 CAGTTGCTCTGGAGGGAGGGAGG + Exonic
906078976 1:43071253-43071275 CAGCAGGGCTGCAGGAAGGTGGG + Intergenic
906211313 1:44013733-44013755 CAGTTTGCTTGGAGAAAGGTAGG - Intronic
906296477 1:44651882-44651904 CATTTGGTTTGGAGGGGGGTGGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907941799 1:59095554-59095576 CACTTGGGCTGGAGGTTGGTGGG - Intergenic
909047431 1:70727678-70727700 CAGGTGGTCTGGATGAAGAAGGG - Intergenic
909618400 1:77639057-77639079 CAGATGGTCGGTAGGTAGGTAGG + Intronic
911950555 1:104168573-104168595 GGGTTGGGTTGGAGGAAGGTAGG + Intergenic
912877817 1:113380005-113380027 TAGTTGGGCTGGAGTCAGGTGGG + Intergenic
915614015 1:157021113-157021135 CAGTTGCTCTGTAGGAAGATGGG + Intronic
915954842 1:160213095-160213117 GAGGTTGTCTGGAGGAAGGCAGG - Exonic
916959915 1:169878937-169878959 TAGTGGGTAGGGAGGAAGGTAGG - Intronic
917407655 1:174724987-174725009 CAGTTGGCCAAGAGGTAGGTAGG + Intronic
917732630 1:177891496-177891518 CACTTGCTCTGGAGCAGGGTAGG + Intergenic
920005757 1:202832661-202832683 CAGGTGCCCTGGGGGAAGGTGGG + Intergenic
920808474 1:209257716-209257738 CAGTTGGTCAGCAGGGAGGAAGG - Intergenic
920839566 1:209542841-209542863 GACTTGGACTTGAGGAAGGTAGG - Intergenic
922823185 1:228498341-228498363 CAGTTTGTTTGCTGGAAGGTAGG + Intergenic
923830582 1:237550987-237551009 CAGCTGTTCTGGAGGAGGGCTGG - Intronic
1063338862 10:5244255-5244277 CATTTGGTCTGGGGGATGGTGGG + Intergenic
1064482795 10:15756489-15756511 CAGTGGGTCGGGGGGAAGGGGGG + Intergenic
1066288140 10:33988518-33988540 CAGTTGGTCTGGAAGAAAAGAGG - Intergenic
1066437875 10:35410813-35410835 CAGTAAGTCTGGAGTAGGGTGGG + Intronic
1066449044 10:35511402-35511424 CAGGTGGTCTGGTGGTAGGAAGG + Intronic
1067298320 10:44988684-44988706 CAGATGGTATGGAGCAGGGTAGG + Intronic
1068095600 10:52487397-52487419 CAATAGGTCTGGAGTAAGGTTGG + Intergenic
1069369762 10:67735064-67735086 CAGTAGGTCTAGAGCAAGGTTGG + Intergenic
1071572888 10:86707792-86707814 GAGTTGGGCTGGGGAAAGGTTGG - Intronic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1072481254 10:95810832-95810854 CATTTAGTGAGGAGGAAGGTAGG - Intronic
1072486968 10:95864875-95864897 CTGTTGGGCTGGGGGGAGGTTGG + Intronic
1072662616 10:97372006-97372028 CAGATGGGCTGTGGGAAGGTGGG - Intronic
1074579789 10:114708176-114708198 CACTTTGTCTGGAGGTAGCTCGG - Intergenic
1075810804 10:125223337-125223359 GAGTTGCTCTGGGGCAAGGTAGG + Intergenic
1077440323 11:2565873-2565895 CACTGGGTCTGGAGGAAGGAGGG + Intronic
1077477494 11:2797292-2797314 CGCTTGGTCTGCAGGCAGGTTGG - Intronic
1077698131 11:4413818-4413840 GAGTTGTTCTGGAGGGAGCTGGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078215856 11:9311441-9311463 CGGTGGGTATGGAGGAGGGTAGG + Intronic
1080600718 11:33818884-33818906 AAGTAGGCCTGGAGGACGGTGGG - Intergenic
1083325531 11:61871174-61871196 CAGGTGGTCTGGAGAAATCTAGG + Intergenic
1084288881 11:68148954-68148976 CACTTGGCCTGGGGCAAGGTTGG - Intergenic
1084501759 11:69539391-69539413 CAGTTAGTCAGAAGGAAGGAAGG + Intergenic
1088470900 11:110186914-110186936 CATTTGCTCTGGAGCAGGGTAGG + Intronic
1088662180 11:112058600-112058622 CAGTTGGGGTGGGGGAAGGGGGG + Intronic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089701885 11:120249702-120249724 CAGAGGGTCAGGAGGAAGGAGGG + Intronic
1089736972 11:120556340-120556362 CAGGTGGTCTGGATGAGGATGGG - Intronic
1089768526 11:120785948-120785970 CAGTTGCTCTGGAGATGGGTTGG - Intronic
1091605797 12:1950209-1950231 AAGTTGGCCTAGAGGAAGGCAGG + Intronic
1092103055 12:5901953-5901975 CAGTTGCTCTGGAGGGATTTCGG + Intronic
1092778846 12:11966813-11966835 CTGCTGGTCTGGAAGAGGGTAGG - Intergenic
1092845797 12:12583916-12583938 CAGCCTGTCTGGAGGAAGGGTGG + Intergenic
1092902202 12:13070508-13070530 CACTTGGGCTGGAGGAAATTGGG + Intronic
1092928562 12:13294223-13294245 CAGTTGGCCTGTAGGAGAGTTGG - Intergenic
1095724112 12:45433451-45433473 GGGTTGGTCAGGAGGGAGGTTGG + Intronic
1096709315 12:53443598-53443620 CGGTGGGTATGGAGGAGGGTAGG - Exonic
1096851415 12:54440434-54440456 CAGTTGCTCTGGATATAGGTTGG + Intergenic
1097599796 12:61676568-61676590 CACTTCCTCTGCAGGAAGGTTGG - Intergenic
1102223999 12:111215167-111215189 CAGGTGTGCTGGAGGAAGGTGGG + Intronic
1104034601 12:125089657-125089679 CAGGTGGACTGGTGGATGGTTGG - Intronic
1104990288 12:132620662-132620684 CAGCTGGTCAGGAGGGAGGAGGG - Intronic
1105441202 13:20416425-20416447 CAGGAGGTCTGGAGGCAGGAAGG + Intronic
1106153288 13:27126925-27126947 TAGTTGGGATGGAGGAAGATGGG - Intronic
1107099517 13:36574738-36574760 CATTTGGTATGGAAGAAAGTAGG - Intergenic
1107280697 13:38730636-38730658 TAATAGGTTTGGAGGAAGGTGGG - Intronic
1108156123 13:47586323-47586345 CATTTTGTGGGGAGGAAGGTGGG + Intergenic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1108687423 13:52832794-52832816 CAGTTGGGGGGTAGGAAGGTGGG + Intergenic
1109309280 13:60672760-60672782 CATCTGCTCTGGAGCAAGGTAGG - Intergenic
1109373063 13:61449537-61449559 CAGTTTGTCAGGAGGATTGTTGG + Intergenic
1111943027 13:94633175-94633197 CAGTTGGTCAGAAGTAAGGATGG + Exonic
1113520686 13:110938379-110938401 CACATGTTCTGGAGAAAGGTGGG + Intergenic
1113973574 13:114209562-114209584 CTGATGGTCTAGAGGAAGGAAGG + Intergenic
1115353446 14:32422269-32422291 CAGTTGGTCTGAAGTGAGGATGG - Intronic
1116613906 14:47109362-47109384 CAGTTGGTCTGGACAAAAGCTGG - Intronic
1118679703 14:68227384-68227406 CAGTTGGTATGTGGGAAAGTAGG - Intronic
1120336779 14:83167612-83167634 CAGTGGGAGTGGAGTAAGGTGGG - Intergenic
1121964730 14:98293635-98293657 CACATGGTGTGCAGGAAGGTGGG - Intergenic
1122113137 14:99515316-99515338 CAGGTGGTCTGGAGAAAGCTGGG - Exonic
1122462629 14:101908026-101908048 CAGCTGCTCAGGAGGAAGGCAGG - Intronic
1122907533 14:104808606-104808628 CAGCTGTTGTGGAGGATGGTGGG + Intergenic
1202847313 14_GL000009v2_random:191626-191648 CAGTTGGTCAGGAGTATGGGAGG - Intergenic
1202916777 14_GL000194v1_random:182183-182205 CAGTTGGTCAGGAGTATGGGAGG - Intergenic
1202876014 14_KI270722v1_random:1013-1035 CAGTTGGTCAGGAGTATGGGAGG + Intergenic
1124415622 15:29471178-29471200 GAGTTGATCTGGATGAAGGTGGG - Intronic
1125743182 15:41981783-41981805 CAGTTGCTCTGGTGGAGGGGAGG + Exonic
1126336565 15:47591524-47591546 CACTTGCTCTGGGGGAAGCTAGG - Intronic
1126991947 15:54388199-54388221 ATTTTGGTCTGGAGGAAGGAAGG - Intronic
1128866652 15:71119619-71119641 CAGTGAGTCTGGTGGCAGGTGGG - Intronic
1131411453 15:92211220-92211242 CAGATGGTCTGGAGGAGATTTGG - Intergenic
1131609678 15:93947817-93947839 GAGAAGGTTTGGAGGAAGGTGGG - Intergenic
1133357343 16:5146305-5146327 CAGTTGCTCTGCTAGAAGGTAGG - Intergenic
1135970698 16:27070121-27070143 GACTTTGTCTGGAGGAAAGTAGG - Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137768632 16:50996812-50996834 CAGTGGGGCTGGGGGAGGGTGGG - Intergenic
1138088103 16:54152425-54152447 CAGGTGGCTTGGAGGAAAGTGGG - Intergenic
1138461046 16:57147794-57147816 CAGCTGGGCTGGAGGAAGTTGGG - Exonic
1139313934 16:66051366-66051388 CATTTGGGCTGGAGGGAGGGAGG + Intergenic
1141477196 16:84281812-84281834 GAGCTGGTGTGTAGGAAGGTGGG + Intergenic
1141599827 16:85118894-85118916 CTGCTGGCCTGGAGGAAGATGGG - Intergenic
1143038463 17:4015096-4015118 CAGCTGGTGTGGAGCAAGGCTGG + Intronic
1145804582 17:27717424-27717446 CAGATGGTCTGGAGGAGATTTGG - Intergenic
1146377483 17:32304286-32304308 TAGCTGGGCTGGAGGAAGGGTGG + Intronic
1146683908 17:34827630-34827652 CGGAGGGTCTGGAGGAAGGGGGG - Intergenic
1147522816 17:41190535-41190557 CAGGTGGTCTGGCAGCAGGTGGG - Exonic
1151042758 17:70882788-70882810 GAGTTGGTGTGGAGGACGGGAGG + Intergenic
1151328540 17:73393495-73393517 CAGATGGGCAGGAGGAAGGGCGG + Intronic
1154122278 18:11661607-11661629 CAGCTGGTCTGAAGGAACCTAGG + Intergenic
1157236213 18:45967414-45967436 CATTTGCACTGGAGGAAGGCAGG + Intergenic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1158246296 18:55436048-55436070 CAGTTTTTCTGGATGTAGGTAGG - Intronic
1158321129 18:56265834-56265856 CAGGTGGGCTGGAAGAAAGTAGG + Intergenic
1159166578 18:64710080-64710102 CAGCTGTCCTGGAGGATGGTGGG + Intergenic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1160055856 18:75479636-75479658 CAGTTGCTCTGGAGCTATGTAGG + Intergenic
1160935619 19:1593117-1593139 GACTTGGGCTGGAGAAAGGTCGG - Intergenic
1161055915 19:2190563-2190585 CAGCTGGTGGGGAGGAAGGCGGG + Intronic
1161778009 19:6274377-6274399 CAGGTGGTGTGGGGGAAGGGGGG - Intronic
1162172776 19:8804554-8804576 GAGGTGGTCTGGAGGAAAGGTGG - Intergenic
1163034105 19:14561641-14561663 AAGTGGGTGGGGAGGAAGGTTGG + Intronic
1163550888 19:17966072-17966094 CAGTTGGACTGAAGGAAGGAAGG - Intronic
1165234121 19:34406744-34406766 CAGTTATTCAGGAGGAATGTGGG - Intronic
1165608303 19:37126606-37126628 CAGTTAGTCTGGTGTAATGTTGG + Intronic
1166009962 19:39934820-39934842 CAGCGGGTCTGGAGGTGGGTTGG + Intergenic
1166011095 19:39943433-39943455 CGGTGGGTATGGAGGAGGGTAGG + Intergenic
1166388672 19:42396794-42396816 CCTTGGGTCTTGAGGAAGGTTGG - Intergenic
1167513594 19:49909954-49909976 CAGTCGGTTTGGAGGGTGGTGGG + Intronic
1167552685 19:50171989-50172011 GAGGTGGACTGGAGGCAGGTTGG - Intergenic
1202674647 1_KI270710v1_random:31797-31819 CAGTTGGTCAGGAGTATGGGAGG - Intergenic
927174978 2:20399556-20399578 CAGTTGGTCTGGGGAAGGATGGG - Intergenic
930914814 2:56673329-56673351 CATTTGTTCTGGAGCAGGGTAGG - Intergenic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933767995 2:85723915-85723937 CAGTTACTCAGGAGGGAGGTGGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935224171 2:101038681-101038703 CAGAAGGGCGGGAGGAAGGTAGG + Intronic
935914572 2:107935484-107935506 AAGTTTGACAGGAGGAAGGTGGG + Intergenic
936308204 2:111360744-111360766 CAGTTGGTCCAGAGGTAGGCAGG - Intergenic
936724451 2:115296124-115296146 CACTTGCTCTGGAGGCAGGGAGG + Intronic
940792578 2:158044129-158044151 AAGTTGGATTGGAGGAAGCTTGG + Intronic
942695332 2:178636124-178636146 GACGTGGTCTGGAGGAAGGATGG - Exonic
943521187 2:188950774-188950796 CAGTTGGTCTGAAGTAAGGGTGG + Intergenic
944783310 2:203042194-203042216 CAGTTGGTCTGAAGTATGGGTGG - Intronic
946309451 2:218874671-218874693 TATTTGGACTGGAGGAAAGTTGG - Intergenic
946359170 2:219208683-219208705 GGCTTGGTCTGGAGGCAGGTAGG + Intronic
947645155 2:231733518-231733540 CACATGGACTGGAGGAAGGGTGG - Intronic
948025282 2:234771554-234771576 AAGTAGGACAGGAGGAAGGTAGG + Intergenic
948109740 2:235445079-235445101 CATTTTGTCTGGAGGAAAGAGGG - Intergenic
948547970 2:238746073-238746095 CAGTGGGCTTGGAGGATGGTGGG - Intergenic
1172529684 20:35621355-35621377 GACTGGCTCTGGAGGAAGGTGGG - Intergenic
1173572509 20:44086596-44086618 GAGGTGGTGTGGAGGGAGGTGGG - Intergenic
1174844096 20:53926922-53926944 CTGTTGGACTGGATGAGGGTAGG - Intergenic
1175129183 20:56776438-56776460 CAGTGGCGCTGGAGGAGGGTGGG - Intergenic
1176637288 21:9258383-9258405 CAGTTGGTCAGGAGTATGGCAGG + Intergenic
1178013006 21:28308190-28308212 TATTTGGTGTGGAGGAAGGCAGG + Intergenic
1179164410 21:38924579-38924601 CAGTGGATCTGCAGGAAGGCTGG - Intergenic
1179554606 21:42164211-42164233 CAGCTGGTCTGCAGGTTGGTAGG - Intergenic
1181102455 22:20550549-20550571 CAGTGACTCAGGAGGAAGGTTGG + Intronic
1181107232 22:20582546-20582568 CAGGTGGTGTGGAGGCAGGCGGG + Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1184211723 22:43040057-43040079 CAGGTGGGCTGGAGCCAGGTGGG - Intronic
1184569250 22:45311428-45311450 CAGCTGAGCTGAAGGAAGGTGGG + Intronic
1185365435 22:50434620-50434642 CATTTGCTCTGGAGGAGGGCCGG + Intronic
949588469 3:5467216-5467238 CATTAGGTCTGGAGCAAGGCTGG + Intergenic
950007632 3:9701705-9701727 CAGGTGGTATGGAGGGAGGGAGG + Intronic
950670900 3:14524863-14524885 CAGTTGAACAGCAGGAAGGTTGG - Intronic
953243866 3:41173526-41173548 CAGTAGGTCTGAATGAAGCTTGG + Intergenic
954150445 3:48654638-48654660 CCGATGGTCTGGGGAAAGGTAGG + Intronic
954628782 3:52037118-52037140 CTGCTGGGCTGGGGGAAGGTGGG + Intergenic
956137555 3:66114109-66114131 TGGTTGGACTGGTGGAAGGTAGG - Intergenic
957621132 3:82594713-82594735 TCTGTGGTCTGGAGGAAGGTGGG + Intergenic
960713058 3:120550227-120550249 GTGTTGGTGTGGGGGAAGGTTGG + Intergenic
961129601 3:124453632-124453654 CTTTTGGACTGGAGGAAAGTGGG - Intronic
961168620 3:124780309-124780331 CAGTGGGGCTGCAGGAAGGAAGG + Intronic
967885708 3:194332149-194332171 CACTTGGCCTGGAGGATGGTGGG - Intergenic
1202749606 3_GL000221v1_random:146636-146658 CAGTTGGTCAGGAGTATGGCAGG - Intergenic
968657368 4:1784483-1784505 CAGGTTGTCTGGAGCCAGGTCGG + Intergenic
969123180 4:4924604-4924626 CACTTGGAATGGAGGAAGTTGGG - Intergenic
969127734 4:4965620-4965642 CAGGAGGTCTTGAGGAGGGTTGG - Intergenic
969946483 4:10788440-10788462 CAGTTAGTTTGGAGGAAGGCTGG - Intergenic
970050122 4:11904991-11905013 CAGCTGGTCTGTGGGAAGGGAGG + Intergenic
970386315 4:15560411-15560433 CAGTTGGGCTGGAGGACTGGGGG + Intronic
970522380 4:16898770-16898792 AGGTTGGTATGGAGGAAGGGAGG + Exonic
972125634 4:35761298-35761320 TAGTTGGAGTGGAGGAAGGAGGG - Intergenic
973093765 4:46171501-46171523 CAGTTGGTGGGGAGGGAGGGAGG - Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975167929 4:71199153-71199175 AAGTTGGTCTAGAGGATTGTGGG + Intronic
979300627 4:119082316-119082338 TTGATGGCCTGGAGGAAGGTCGG - Intergenic
980115964 4:128679186-128679208 CAGTGGGCATGGTGGAAGGTGGG + Intergenic
984814669 4:183825336-183825358 CAGTAGGTTGGGAGGAAGGTGGG + Intergenic
984939464 4:184918612-184918634 CAGATGGTCTGGAGGAGATTTGG + Intergenic
984985252 4:185322419-185322441 GATTTGGTCTTGGGGAAGGTGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985223856 4:187738133-187738155 CATTTGCTCTGGAGTAGGGTAGG + Intergenic
989342184 5:40388410-40388432 CAGCTGGACTGGAGCAAAGTAGG - Intergenic
989730950 5:44647994-44648016 CAGTAGGTCTGGAGGAGCCTGGG + Intergenic
990088613 5:52011556-52011578 TTGTGGGTCTGGATGAAGGTTGG - Exonic
990364261 5:55053766-55053788 CAGCTGTTCTGGGGGATGGTCGG - Intergenic
990653838 5:57932914-57932936 CACTTGCTCTGGAGGAAGCCAGG + Intergenic
990725143 5:58745076-58745098 CAGTTGGTCTCGGGGAATGGGGG - Intronic
992459204 5:76944351-76944373 CTGGTGCTCTGGAGGAAGATGGG + Intergenic
997282080 5:132655828-132655850 GAGCTGGTCGGGAGGAAGGGAGG + Intergenic
997355893 5:133262845-133262867 CAGGTGGTGTGGGGGGAGGTGGG + Intronic
999496760 5:152106795-152106817 CAGTAGGTCTGGGGGATGGCGGG - Intergenic
999591803 5:153156426-153156448 CAGTTGGTCTGGGAGAAGCCTGG - Intergenic
1000412715 5:160950323-160950345 CAGTTGGCCTTGAGCAAAGTAGG + Intergenic
1000716751 5:164653561-164653583 CACTTGCTCTGGAGTGAGGTGGG - Intergenic
1001220173 5:169893840-169893862 CAGTTGGAATGGAAGAAGGCAGG + Intronic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1001979711 5:176030579-176030601 CAGTAGGTTTAGAGGAAGGGTGG + Intronic
1002237706 5:177813184-177813206 CAGTAGGTTTAGAGGAAGGGTGG - Intergenic
1003153423 6:3571641-3571663 CAGTAGGGCTGGAGCAAGGCTGG + Intergenic
1003249513 6:4413686-4413708 AGGTGGGCCTGGAGGAAGGTGGG - Intergenic
1005028467 6:21487067-21487089 CACTTGGCCTGGAGAAAGGGCGG - Intergenic
1005618466 6:27597970-27597992 CAGTTTGTCTGGGGGGAGGGGGG - Intergenic
1005994040 6:30921095-30921117 CAGTTCTTCTGGTGGAAGGAGGG - Exonic
1009308448 6:62120900-62120922 CAGTTACTCTGGTGAAAGGTTGG - Intronic
1010198877 6:73265573-73265595 GAGCTGGATTGGAGGAAGGTGGG + Intronic
1010374837 6:75155661-75155683 CAGTTGTTTTGGAGGAACTTAGG - Exonic
1010981455 6:82374848-82374870 CAGTGGGCCTGGAAGAAGGGTGG + Intergenic
1014179604 6:118370765-118370787 GAGTTGGCCTGGAGAGAGGTGGG - Intergenic
1015037110 6:128669216-128669238 TATGTGGTCTGGAGGAAAGTAGG - Intergenic
1016384968 6:143521909-143521931 CAGAGGGTCTGGATGCAGGTGGG + Intergenic
1020153043 7:5698257-5698279 CAGTTGTACTGGAGCAAGGAGGG + Intronic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021537732 7:21724333-21724355 CAGCTGGTTTGGAAGATGGTGGG + Intronic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1023146028 7:37151928-37151950 CAGTTGCTCTGTTGGCAGGTGGG - Intronic
1023812701 7:43924726-43924748 CAGGTGGGCTGGAGGTAGGAAGG + Intronic
1024295741 7:47840662-47840684 CAGATGGTTTTGAGGAAGGGTGG - Intronic
1028165882 7:87538191-87538213 CAGTTGGCCTGGAGGCTGGTTGG + Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031701217 7:124929554-124929576 CAGGTGGCTTGGGGGAAGGTTGG - Intronic
1031943661 7:127816001-127816023 CAGCTGGTCTGCAGGAGGGAAGG - Intronic
1032916472 7:136495460-136495482 CCCTTGGTTTGGAAGAAGGTAGG + Intergenic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1035911177 8:3567727-3567749 CAGAGGATGTGGAGGAAGGTTGG - Intronic
1036166347 8:6437675-6437697 CAGCTGGTGTGAAGGAAGGATGG - Intronic
1036448229 8:8842143-8842165 CAGTTTCTCCGGAAGAAGGTAGG - Intronic
1036713729 8:11100756-11100778 CAGTTTCTGGGGAGGAAGGTAGG + Intronic
1037694939 8:21215316-21215338 CAGGTGGTGTGGAAGTAGGTAGG + Intergenic
1039471122 8:37814441-37814463 CAGAAGGTCTGGAGGCAGGCGGG - Intronic
1039692720 8:39879770-39879792 CAGATGGTCTGGAGGAAATTTGG + Intergenic
1041002375 8:53465306-53465328 CAGATGGTCTGGAGGAGATTTGG - Intergenic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1047198585 8:122744116-122744138 AATTTGGTCTTGAAGAAGGTAGG + Intergenic
1047253731 8:123200271-123200293 CCGGTGTTCTGGAAGAAGGTGGG - Intronic
1057217763 9:93238859-93238881 CTGTTGGTCAGGTGGAAGGCTGG + Intronic
1058574894 9:106390288-106390310 CATTAGGTCTCGATGAAGGTAGG + Intergenic
1058609135 9:106756058-106756080 CAGGTGATCTGGAAGAGGGTGGG - Intergenic
1061114266 9:128598689-128598711 CACTTGGTTTGGAGGGGGGTGGG + Intronic
1061407150 9:130398646-130398668 CTGGTGGTCTGGTGGAAGGACGG + Intronic
1061421983 9:130477622-130477644 CTCTTGGCCTGGAGGAAGGATGG + Intronic
1061650421 9:132043867-132043889 CAGTTGCCCTGAAGGAAGGTGGG - Intronic
1062675373 9:137740142-137740164 CAGCTGCTCTGCAGGAAGGCTGG - Intronic
1203786235 EBV:129404-129426 CAGTTGGTATAGGGCAAGGTTGG + Intergenic
1203718248 Un_KI270742v1:176724-176746 CAGTTGGTCAGGAGTATGGCAGG - Intergenic
1203652466 Un_KI270751v1:140417-140439 CAGTTGGTCAGGAGTATGGGAGG - Intergenic
1185820296 X:3196433-3196455 AAGTTGCTCTGAAGGTAGGTAGG + Intergenic
1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1188385880 X:29556929-29556951 CATTTAGTCTGGAGAAAGGTTGG + Intronic
1190048932 X:47134786-47134808 CATTTAGTATGGAGGAAGCTGGG + Intergenic
1192297090 X:69862245-69862267 CACTTGCTCTGGAGGAAGCCAGG - Intronic
1192368246 X:70492944-70492966 CAGGTGGTCTGAAGGGAGGTGGG - Intronic
1194552717 X:95321175-95321197 CACTTGCTCTGGAGTAAGTTAGG + Intergenic
1198530178 X:137544592-137544614 CAGTTGGTATGATGGCAGGTGGG + Intergenic
1201172402 Y:11281574-11281596 CAGTTGGTCAGGAGTATGGGAGG - Intergenic
1201496182 Y:14593380-14593402 CAGATGGTCTGGAGGAGATTTGG + Intronic