ID: 1072378699

View in Genome Browser
Species Human (GRCh38)
Location 10:94843093-94843115
Sequence TCTCACCCAGTGATGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072378699_1072378702 1 Left 1072378699 10:94843093-94843115 CCCTCTACCATCACTGGGTGAGA 0: 1
1: 0
2: 2
3: 8
4: 155
Right 1072378702 10:94843117-94843139 AAGTGCATTACTCCTATGTATGG 0: 1
1: 0
2: 1
3: 3
4: 89
1072378699_1072378704 13 Left 1072378699 10:94843093-94843115 CCCTCTACCATCACTGGGTGAGA 0: 1
1: 0
2: 2
3: 8
4: 155
Right 1072378704 10:94843129-94843151 CCTATGTATGGCAGTTTAATTGG 0: 1
1: 0
2: 2
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072378699 Original CRISPR TCTCACCCAGTGATGGTAGA GGG (reversed) Intronic
900861496 1:5235963-5235985 TCTTTCCCAGTGGTGGCAGAGGG - Intergenic
901387921 1:8923306-8923328 TCTGATGCAGTGATGGCAGATGG - Intergenic
902139206 1:14338130-14338152 TCTGACCCAGTGATGGTTTTAGG + Intergenic
904419671 1:30383681-30383703 ACTCATCCTGTGATGATAGATGG - Intergenic
905352242 1:37355979-37356001 CCCAACCCAGTGGTGGTAGAGGG - Intergenic
916443784 1:164853362-164853384 TCACACCTAGTGATGGGATAAGG + Intronic
918218658 1:182415693-182415715 ACACACCCACTGATGGGAGAAGG + Intergenic
919762280 1:201105786-201105808 CCTCAGCCAGTGCTGGCAGAAGG + Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922652844 1:227356001-227356023 ATTCACCCAGTGATGGACGAAGG - Intergenic
923976828 1:239273548-239273570 TCTCATCCCATGATGGAAGATGG - Intergenic
1065378066 10:25062680-25062702 ACTCACACAGTGGTGGAAGAGGG + Intergenic
1067076286 10:43186407-43186429 ACTCACCCAGTGGTGGAAGGTGG - Intergenic
1069490798 10:68858806-68858828 TCTCTCCTACTGATGGAAGAGGG - Intronic
1069769870 10:70891377-70891399 CCTCCACCAGTGAGGGTAGAGGG + Intergenic
1071505809 10:86230852-86230874 TCCCACCCAGGGCTGGCAGATGG + Intronic
1072378699 10:94843093-94843115 TCTCACCCAGTGATGGTAGAGGG - Intronic
1072531787 10:96326531-96326553 TCTCACCCTGGGATTGTGGAAGG - Intronic
1075919706 10:126200491-126200513 TCTCACCAAGTAGTGGGAGATGG - Intronic
1076556396 10:131324316-131324338 ACTCACCCAGTGAGTGTGGAAGG + Intergenic
1076556404 10:131324361-131324383 ACTCACCCAGTGAGTGTGGAAGG + Intergenic
1076556426 10:131324494-131324516 ACTCACCCAGTGAGTGTGGAAGG + Intergenic
1076556454 10:131324671-131324693 ACTCACCCAGTGAGTGTGGAAGG + Intergenic
1076556461 10:131324716-131324738 ACTCACCCAGTGAGTGTGGAAGG + Intergenic
1076556468 10:131324760-131324782 ACTCACCCAGTGAGTGTGGAAGG + Intergenic
1077116920 11:889351-889373 TGTCACCCAGAGATGGCAGCTGG - Intronic
1078834571 11:15014833-15014855 TCTCACCCAGTCAGGGGAAATGG - Intronic
1079082965 11:17427083-17427105 TCTCCCCCAGTGCGGCTAGAAGG + Exonic
1080490447 11:32757600-32757622 TCTCCCCCAGAGACTGTAGAAGG - Intronic
1080513819 11:33001427-33001449 TCTCACCCAGTGAAGAGAAATGG + Intergenic
1081350124 11:42041866-42041888 TTTCTCACAGTGATGGTACATGG + Intergenic
1082879443 11:58023920-58023942 TGCCACACAGAGATGGTAGAGGG + Exonic
1087507785 11:99049015-99049037 TCTCTCCCAGGAAGGGTAGAGGG - Intronic
1090225842 11:125071820-125071842 TATCTCCCAGTGCTGGTGGAGGG + Intronic
1092120484 12:6040196-6040218 TGTCACCTAGTGGTGGTAGCAGG + Intronic
1096060071 12:48690358-48690380 TCTCACCCTTTGAAGGTACAAGG + Exonic
1096269363 12:50152099-50152121 CCTCATTCAGTTATGGTAGAGGG + Intronic
1097451701 12:59744610-59744632 TCTCTGCCAGTGAGGGCAGAGGG - Intronic
1098201772 12:68063947-68063969 TCTCACCTAGTCAGGGTACACGG + Intergenic
1102466568 12:113133973-113133995 TCTCACCCAGGGCTGGTGGAGGG + Intronic
1103187281 12:118969919-118969941 GGTCACGCAGTGGTGGTAGATGG - Intergenic
1104553988 12:129783289-129783311 TCTGACCCTCTGAAGGTAGATGG - Intronic
1107263823 13:38527052-38527074 TGTCATCCAGAGATTGTAGAAGG - Intergenic
1108457096 13:50627240-50627262 TCTCACGCATTGCTGGTAGGAGG + Intronic
1108749402 13:53432169-53432191 TCTCTCCGAGTGATGACAGACGG + Intergenic
1110796144 13:79640653-79640675 TCTCATCCACTGCTGGTAGGAGG - Intergenic
1111641346 13:90974399-90974421 ACTCACCCAGTGAAGGTGAAAGG - Intergenic
1117760637 14:59024259-59024281 TCTCACCCAGCAATTCTAGAAGG - Intergenic
1119570510 14:75667007-75667029 TCCCACCAAGTGATGCTAAAAGG - Intronic
1123899618 15:24863270-24863292 TCTCACCCTGTGATGCAAGGTGG - Intronic
1125359270 15:38848536-38848558 TGTTACCCATTCATGGTAGATGG - Intergenic
1126662614 15:51047544-51047566 CTCCTCCCAGTGATGGTAGAAGG + Intergenic
1127349991 15:58141678-58141700 TCTCACCCAGTCCTGGTGGAAGG - Intronic
1128637187 15:69310354-69310376 TCTCATCCACTGCTGGTAGGTGG - Intronic
1128781541 15:70361949-70361971 CCTTGCCCAGTGATGGTAGAGGG - Intergenic
1131342788 15:91618366-91618388 TCTCACCCAATCATGGTTCATGG - Intergenic
1133845248 16:9447428-9447450 AATCACCCAGAGATGGTAGAAGG - Intergenic
1134674022 16:16076799-16076821 TCTCCCCTTGTGATGGTAAATGG + Intronic
1135729690 16:24883677-24883699 TCTAACCTAGTGAAGGAAGAGGG - Intronic
1142775352 17:2133572-2133594 TGTCACCCAGGGATGGGATACGG + Intronic
1144085949 17:11808540-11808562 TCTCAGCCAGTGACAGAAGAGGG + Intronic
1144115589 17:12086741-12086763 TTTAACCAAGTGATGGTAGAAGG - Intronic
1145203504 17:20967922-20967944 TCTCACCAAGTGAGGCAAGAGGG - Intergenic
1151854032 17:76709328-76709350 CCTCACGCGGTGATGGTGGAGGG - Intronic
1155116650 18:22775285-22775307 TCTTACTCATTGATGTTAGAAGG - Intergenic
1155578296 18:27273619-27273641 TCTTACCCAGAGAGGGGAGATGG + Intergenic
1155847070 18:30721251-30721273 TGTGACCCAGAGAAGGTAGAAGG + Intergenic
1156400624 18:36736345-36736367 TCTCCACCAGTGAGGGCAGAGGG + Intronic
1157028541 18:43876592-43876614 TCTCACGCAGTCATGGCAGGGGG - Intergenic
1157930556 18:51817197-51817219 TCTCATCTATTGTTGGTAGAAGG - Intergenic
1162879118 19:13644811-13644833 TCTGAGCCAATGAAGGTAGATGG + Intergenic
1163883413 19:19946443-19946465 TCTGATGCAGTGAAGGTAGATGG - Intergenic
1167830606 19:52018362-52018384 TCTTACCCAGTGATACTAGGTGG + Exonic
926114533 2:10204124-10204146 TCTGTCCCAATGATGGTAGTTGG - Intronic
932406749 2:71518044-71518066 TCTCACCCTGGGATGGGAGTGGG + Intronic
933615863 2:84481986-84482008 TCACACCCCGTGATGCTAGATGG + Intergenic
935690661 2:105728454-105728476 TCTGATTCAGTGATGGTGGATGG + Intergenic
935722381 2:105990859-105990881 TCTCACCCATTAAGGGGAGAGGG - Intergenic
936058046 2:109276099-109276121 TCGGACCCAGTGATGGTAGAAGG + Intronic
943504735 2:188740896-188740918 TCTCAACCAATGATGGTGTAAGG + Intronic
944067385 2:195633510-195633532 TCTCTGCCAGTGAGGGCAGAGGG + Intronic
948998266 2:241595776-241595798 TGTCACCCTCTGCTGGTAGAGGG - Intronic
1170128045 20:12987654-12987676 TCTCACCCATTGAAGGCACACGG - Intergenic
1174240896 20:49133734-49133756 TCTTACCCACTGAGGGTGGAGGG + Intronic
1174973565 20:55305647-55305669 CCTCACCCAGTGAGGAGAGATGG - Intergenic
1175625767 20:60487172-60487194 TCTCAACCAGTGCTGCTGGATGG + Intergenic
1177126634 21:17201850-17201872 TCTCACACAGGGATGGTAAGAGG + Intergenic
1182418705 22:30238100-30238122 TCTCTCCCAGTGAATGTGGAAGG - Intergenic
1183910116 22:41072690-41072712 TCTCACACACTGAGAGTAGAGGG + Intergenic
949622070 3:5824687-5824709 TCAAACCCAATGATGGTATATGG - Intergenic
949708213 3:6843003-6843025 TCTCCACCAGTGAGGGCAGAGGG - Intronic
953847098 3:46436331-46436353 ACTGACTCAGTGATGGGAGAAGG - Intronic
953855378 3:46495740-46495762 TCTCAACTAGTGAGGGAAGAAGG - Intergenic
955830136 3:62992822-62992844 TCCCACCCAGTGGTGGTAATGGG - Intergenic
958863483 3:99472062-99472084 TCTGAGCCTGTGATGGAAGAAGG - Intergenic
961655507 3:128439390-128439412 TCTGGCCCAGGGATGGCAGAGGG + Intergenic
962835897 3:139188074-139188096 ACTCACCTAGTAATGGTAGGTGG - Intronic
963892680 3:150653254-150653276 TCTCAGGCACTGAGGGTAGAAGG - Intergenic
964646725 3:158966591-158966613 TCTCACCCAGTATTGGTTAAAGG + Intronic
965080190 3:164023645-164023667 TCTGATGCAGTGATGGCAGATGG + Intergenic
965549038 3:169945820-169945842 TCTTCCCCATTGATGGTATAGGG + Intergenic
966419313 3:179721719-179721741 TCTCACCCAGTCTCTGTAGAAGG - Intronic
968897054 4:3410511-3410533 TCCCGCCCAGTGCTGGGAGACGG - Intronic
969031681 4:4220769-4220791 ACCCATCCAGTGATGGCAGAGGG + Intronic
970695856 4:18676202-18676224 TCTCAGCCAGTGGTGGTATTGGG + Intergenic
970950847 4:21753652-21753674 ACTAACCCAGTGAGGGTACATGG - Intronic
974499767 4:62684510-62684532 TCTCACCCAGTTGGGGTACATGG - Intergenic
974662554 4:64912051-64912073 TCTCACACAGTGATGATAAGAGG - Intergenic
976883578 4:89960325-89960347 TCTCCACCAGTGAGGGCAGAGGG + Intergenic
977893540 4:102339554-102339576 TCTGACCCTGTGATGCCAGAAGG - Intronic
978756685 4:112310296-112310318 ACTCAACTAGAGATGGTAGAAGG + Intronic
978912190 4:114077399-114077421 TCCCACCCAGCTATGGTATAAGG + Intergenic
983943225 4:173558221-173558243 TCTCTCCCAGTTATGACAGAGGG + Intergenic
984397752 4:179222847-179222869 TCTCACCCAGTGTTGGCATGAGG + Intergenic
985576646 5:676371-676393 GCCCACCCAGAGCTGGTAGATGG + Intronic
987825398 5:23024673-23024695 TCTCACCTAGTGGTAGGAGAGGG - Intergenic
989455619 5:41640064-41640086 TCCCAGCCAGTGATGGCAAAAGG + Intergenic
992545750 5:77812349-77812371 TCTCTCCAAGTGAGGGTCGAAGG - Intronic
994627018 5:102232661-102232683 TCTCCACCAGTGAGGGCAGAGGG + Intergenic
996002502 5:118381583-118381605 TCTCTCCCAGTGAAGTTACATGG + Intergenic
996101494 5:119449901-119449923 TCTCTGCCAGTGAGGGCAGAGGG + Intergenic
1001013206 5:168117195-168117217 TCTCACCAACAGATGGAAGAGGG + Intronic
1001969554 5:175943665-175943687 TCTCCACCAGTGAGGGCAGAGGG + Intronic
1002247882 5:177900088-177900110 TCTCCACCAGTGAGGGCAGAGGG - Intergenic
1003702507 6:8484240-8484262 TTTCACCTAGTAATGGAAGAAGG - Intergenic
1004273288 6:14213324-14213346 AATCACCCAGTGATTGGAGAAGG + Intergenic
1004620202 6:17324928-17324950 TCTGATGCAGTGATGGCAGATGG + Intergenic
1006957543 6:37887796-37887818 TCTTAGCCATTGATTGTAGAAGG + Intronic
1011233835 6:85193194-85193216 TCTCTACCAGTGAGGGCAGAGGG - Intergenic
1011493542 6:87916676-87916698 TCTCCACCAGTGAGGGCAGAGGG - Intergenic
1015911473 6:138171558-138171580 TCTCTCCCAGTGAGGGTTGGGGG - Intronic
1018296630 6:162353099-162353121 TCTCACTAAGTGGTGGTAGCAGG + Intronic
1019363984 7:621931-621953 GCTCCCCCAGTGCTGCTAGAAGG + Intronic
1020605121 7:10327287-10327309 TCTCCCCCTGGGATGGAAGAGGG - Intergenic
1021876832 7:25057635-25057657 TCAAACCCAGTCATGGCAGATGG + Intergenic
1021945929 7:25727082-25727104 CCTCACCCAGTGAAGTGAGAAGG - Intergenic
1023671202 7:42578595-42578617 TTCCACCAAGTGATGGTAGATGG + Intergenic
1028103235 7:86847056-86847078 TGTAACCCACTGATGGTACAGGG - Intronic
1028967355 7:96817083-96817105 CTTAACCCAGTGATGGTACAAGG - Intergenic
1029285494 7:99462893-99462915 TGTGACCCAGTGATTGCAGATGG - Intronic
1030827481 7:114177338-114177360 TTTCACACATTGATGGTAGAAGG - Intronic
1032163482 7:129527887-129527909 TTGCACCCATTGAGGGTAGATGG + Intergenic
1035091746 7:156318798-156318820 CCTCACGCAGTGATGGGAGCGGG + Intergenic
1042330984 8:67580315-67580337 TCTCAACTTGTGTTGGTAGAAGG - Intronic
1042737006 8:72000936-72000958 TCTCCCCCAGTGATGGGCAAGGG + Intronic
1045442542 8:102228476-102228498 TCTCCACCAGTGAGGGCAGAGGG - Intronic
1047170148 8:122484776-122484798 TCTCACCCAGTGATGGTTTAAGG + Intergenic
1049210136 8:141382372-141382394 GTTCATCCAGTGATGGTTGACGG + Intergenic
1049986538 9:956835-956857 TCTCACCCAGAGATCATAGGTGG + Intronic
1050483900 9:6114281-6114303 TCTGAGCCTGCGATGGTAGAGGG - Intergenic
1050859251 9:10404225-10404247 TCTCAACCAGGGGTGGTGGAAGG + Intronic
1053036426 9:34830629-34830651 ACTCACCCAGTGATGGTGCTGGG + Intergenic
1053179556 9:35957129-35957151 CTTCACTCAGTGATGGTGGAAGG - Exonic
1055683288 9:78741476-78741498 TCTCCCCCAGTGGCGGGAGAAGG + Intergenic
1057913203 9:99035957-99035979 CCTCACCCAATGCTGGGAGAGGG + Intronic
1059114105 9:111585408-111585430 TCTCACCCATAGAGGGTACAGGG + Intronic
1061182401 9:129032533-129032555 TCTCTGCCAGTGAGGGCAGAGGG - Intergenic
1061597163 9:131638708-131638730 TCTGACCAAGTGATGCTGGAAGG - Exonic
1186989853 X:15055639-15055661 TCAGAGCCAGTGATGGTGGAGGG - Intergenic
1188669847 X:32868930-32868952 TCTCACCCAGTCAGGGTGCACGG - Intronic
1191743758 X:64464074-64464096 TCTCACCCAGTGAGGAGAAATGG + Intergenic
1192490810 X:71576039-71576061 TCTCAGCCAGGTCTGGTAGAGGG + Intergenic
1193242409 X:79186481-79186503 TCCCAGCCAGTGATAGGAGAAGG + Intergenic
1199389018 X:147258088-147258110 TCTCATTCAGTGATGAGAGAGGG - Intergenic
1200983459 Y:9283189-9283211 TCCCACCTGGTGAAGGTAGAAGG - Intergenic
1202126920 Y:21576498-21576520 TCCCACCTGGTGAAGGTAGAAGG + Intergenic