ID: 1072379526

View in Genome Browser
Species Human (GRCh38)
Location 10:94853275-94853297
Sequence CATTATGCACAAAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072379526_1072379531 13 Left 1072379526 10:94853275-94853297 CCTTCCTTCCTTTGTGCATAATG 0: 1
1: 0
2: 2
3: 29
4: 287
Right 1072379531 10:94853311-94853333 AAAGAAAATAGAGTTCCAGGAGG 0: 2
1: 0
2: 5
3: 53
4: 494
1072379526_1072379530 10 Left 1072379526 10:94853275-94853297 CCTTCCTTCCTTTGTGCATAATG 0: 1
1: 0
2: 2
3: 29
4: 287
Right 1072379530 10:94853308-94853330 ATTAAAGAAAATAGAGTTCCAGG 0: 2
1: 0
2: 3
3: 36
4: 569
1072379526_1072379532 22 Left 1072379526 10:94853275-94853297 CCTTCCTTCCTTTGTGCATAATG 0: 1
1: 0
2: 2
3: 29
4: 287
Right 1072379532 10:94853320-94853342 AGAGTTCCAGGAGGCCATGCTGG 0: 2
1: 0
2: 5
3: 23
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072379526 Original CRISPR CATTATGCACAAAGGAAGGA AGG (reversed) Intergenic
900273799 1:1809937-1809959 CATTTTACTCAAAGGAGGGAGGG + Intronic
901658347 1:10783392-10783414 CCTTTTGCCCAAAGAAAGGAGGG + Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
904394760 1:30212447-30212469 CATTAGGCACCAAGCAAAGAGGG - Intergenic
904401378 1:30258870-30258892 CAATATGAAGGAAGGAAGGAAGG + Intergenic
905324921 1:37145144-37145166 CATTTTACCCAGAGGAAGGAAGG + Intergenic
905868530 1:41389934-41389956 TATTCTGCACATATGAAGGAAGG + Intergenic
905954364 1:41979749-41979771 CACCATGCAGCAAGGAAGGAGGG - Intronic
905961067 1:42042939-42042961 CATTAAGCACTAAGGAAAGTAGG + Intergenic
906708961 1:47915197-47915219 CATCATGCACAAAAGCAGGGAGG + Intronic
907331127 1:53672321-53672343 CATTTCGTACAAAGGAAGGCGGG - Intronic
907564826 1:55425061-55425083 CCTTATGGGAAAAGGAAGGAAGG - Intergenic
907971343 1:59384609-59384631 CATTAAGCATAGAGGAAAGAGGG + Intronic
908158675 1:61384483-61384505 CATAATACACAAATGAAAGAAGG - Intronic
908253538 1:62284053-62284075 CATAATACAGGAAGGAAGGAAGG + Intronic
909837455 1:80274999-80275021 CATTATTACCAAAGGAAGTATGG - Intergenic
909899348 1:81113012-81113034 CATAATGAACAAAGGAAGAGTGG + Intergenic
910280616 1:85496955-85496977 CATTCTGCATAAAGGAACAAAGG + Intronic
911211394 1:95142462-95142484 CAAAATGCACAAAGCAAGGAAGG + Intronic
911502129 1:98700409-98700431 CATTTTGGTCAAAGAAAGGAAGG + Intronic
911519456 1:98911036-98911058 CATCAGGCAGAAAGGGAGGAAGG - Intronic
912956672 1:114158646-114158668 CATTCTGAAAAAAGGAAGAAAGG - Intergenic
913321457 1:117591560-117591582 CATTAAGCTCCAAGAAAGGAGGG + Intergenic
913560453 1:120013651-120013673 CATTATGGACATGGGAAGAAAGG + Intronic
913637672 1:120779927-120779949 CATTATGGACATGGGAAGAAAGG - Intergenic
914281039 1:146173059-146173081 CATTATGGACATGGGAAGAAAGG + Intronic
914542082 1:148623998-148624020 CATTATGGACATGGGAAGAAAGG + Intronic
914624559 1:149447246-149447268 CATTATGGACATGGGAAGAAAGG - Intergenic
914906421 1:151749701-151749723 CATCATGCACACAGAGAGGAGGG + Intergenic
915985016 1:160455878-160455900 CAATATGTACAAAGGAAGAAAGG - Intergenic
916794171 1:168150303-168150325 CACTAGGAAGAAAGGAAGGAAGG + Intergenic
917731624 1:177880637-177880659 CATTATTGTCATAGGAAGGATGG + Intergenic
919364676 1:196642506-196642528 CATTATGCTCAGAAAAAGGATGG - Intergenic
921663767 1:217841153-217841175 CAATATGCAGAAATGAAGTAAGG + Intronic
922198282 1:223378927-223378949 CATTATGGTCAATGGAATGAGGG - Intergenic
922217257 1:223530251-223530273 CCTTGTGGACAAAGGAAAGACGG + Intergenic
922273819 1:224058136-224058158 CAAAACGCACAAAGCAAGGAAGG + Intergenic
923900381 1:238320079-238320101 CTTTAGGCAAATAGGAAGGAAGG + Intergenic
924921145 1:248630419-248630441 CATAATTCACAAAAAAAGGAGGG + Intergenic
1062984225 10:1752488-1752510 CACCATCCACACAGGAAGGATGG + Intergenic
1065422885 10:25566495-25566517 AATAATGAAAAAAGGAAGGAAGG - Intronic
1065428510 10:25630463-25630485 CAAAATGCACAAAGCAAGCAAGG - Intergenic
1065464433 10:26004026-26004048 AATTATTCATAAAGAAAGGAAGG - Intronic
1067052885 10:43034209-43034231 AGCTATGCACAAAGGAAGGCAGG - Intergenic
1069945758 10:71984396-71984418 CAAAACGCACAAAGCAAGGAAGG - Intronic
1071190817 10:83097552-83097574 CTTTATTCACAAAGAAATGAAGG + Intergenic
1072379526 10:94853275-94853297 CATTATGCACAAAGGAAGGAAGG - Intergenic
1072391237 10:94989406-94989428 CATTATGCATAAAAGAAGGAAGG - Intergenic
1073042604 10:100617726-100617748 CATTATTTACAAGGGAAGGCAGG + Intergenic
1073251223 10:102121198-102121220 CAGTCTGCAAGAAGGAAGGATGG - Intergenic
1073932705 10:108594563-108594585 AATCATGCAGAAAGGAAGGAAGG - Intergenic
1075889041 10:125929711-125929733 CAAAACGCACAAAGCAAGGAAGG + Intronic
1077005406 11:353039-353061 CAAAACCCACAAAGGAAGGAAGG - Intergenic
1078825109 11:14922478-14922500 TATTAAGCACAAAAAAAGGAAGG + Intronic
1079250790 11:18786016-18786038 CAATGGGGACAAAGGAAGGAGGG + Intronic
1079970499 11:27030428-27030450 CATTATCTAGAAAAGAAGGATGG + Intergenic
1081531378 11:43962014-43962036 CAAAATGCACAAAGTAAGAAGGG - Intergenic
1083911124 11:65710751-65710773 CAAAATGCACAAAGCAAGGAAGG - Intergenic
1083969482 11:66065351-66065373 CATTATGTACACAGGAACAAAGG - Intronic
1084655310 11:70511827-70511849 AATTATTTACAAAGGAAGGCAGG - Intronic
1085660989 11:78366626-78366648 GAATATGCACAAAGTGAGGATGG + Intronic
1085877399 11:80425425-80425447 CATCATGTGCAAAGGAAAGAAGG - Intergenic
1086143401 11:83523984-83524006 CCTTTTGCACAGAGGAAGAAGGG - Intronic
1087166100 11:95004802-95004824 CAGAATGAATAAAGGAAGGAAGG - Intergenic
1087867722 11:103252424-103252446 CATTATGAAAAATGGTAGGAAGG - Intronic
1088726594 11:112643002-112643024 CTTTATGCACGAAGAAACGAAGG - Intergenic
1089034523 11:115373075-115373097 CATTCTGCTCAAAGCAATGAGGG + Intronic
1092512224 12:9169486-9169508 CATTATGAATGAAGAAAGGACGG + Exonic
1092971827 12:13703263-13703285 CATTATGCCCAAATAAGGGAGGG - Intronic
1095174711 12:39078302-39078324 GAGTATTGACAAAGGAAGGAAGG + Intergenic
1095857407 12:46875181-46875203 AAATATAAACAAAGGAAGGAAGG + Intergenic
1096402525 12:51319104-51319126 AATTAGGGACAAAGGAAGGGAGG - Intronic
1096780561 12:53989492-53989514 CACCAGGCACAAAGGGAGGAGGG - Exonic
1097488120 12:60231800-60231822 CAGTATAGAGAAAGGAAGGAAGG - Intergenic
1098877826 12:75884929-75884951 CATTATACACACAAGAAGAAAGG + Intergenic
1100291423 12:93218294-93218316 CACTAGTCACAAGGGAAGGAGGG + Intergenic
1101375506 12:104167978-104168000 CTTTATTCACTAAGGAAGGATGG - Intergenic
1101391198 12:104302303-104302325 CTATATGCATAAAGGAAGGTAGG + Intronic
1104191143 12:126482613-126482635 CATGAGGAACGAAGGAAGGAAGG - Intergenic
1104787778 12:131460801-131460823 CATTACTCATAAAGGCAGGAAGG + Intergenic
1105364977 13:19756328-19756350 CAAAATGCTCAAAGCAAGGAAGG - Intronic
1107004525 13:35593257-35593279 CATGTTTCACAAAGGAACGAGGG + Intronic
1107044693 13:35982205-35982227 CACTTTTCACAAAGGAAAGAGGG + Intronic
1107148842 13:37089174-37089196 CATTAAATACAAAGGCAGGAGGG + Intergenic
1108413150 13:50170740-50170762 CATTTGGCACTAAGCAAGGATGG + Intronic
1109217441 13:59605675-59605697 CATTAAGCAGAAGGAAAGGAAGG + Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1109928666 13:69183540-69183562 CAAAATGCACAAAGAAAGAAAGG - Intergenic
1110079180 13:71289476-71289498 CAATAGGAAGAAAGGAAGGAAGG + Intergenic
1110570815 13:77001054-77001076 CTTTATGCACCAAGGAAGAAAGG - Exonic
1111379389 13:87426902-87426924 CATAATGAGCAAAGGAAGTATGG - Intergenic
1111997380 13:95178092-95178114 CTGTATGGACAAAGGAAAGAAGG + Intronic
1112729818 13:102348431-102348453 CATTCTGCACTATGGATGGAGGG - Intronic
1113448556 13:110389049-110389071 CATCAGACACAAAGGAAGGATGG - Intronic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115479114 14:33844393-33844415 CCTTATCCACACAGTAAGGAAGG - Intergenic
1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG + Intergenic
1116577180 14:46588783-46588805 CAAAATGCACAAAGTAAGGAAGG + Intergenic
1117010834 14:51468803-51468825 CATAATAAAGAAAGGAAGGAAGG - Intergenic
1117139371 14:52771955-52771977 CATTTTGGACAAAGGAAAAAAGG - Exonic
1117202032 14:53400481-53400503 CAATGTGCAAAAAGGAAGAAAGG - Intergenic
1118536109 14:66766616-66766638 CAATATTCCCAAAAGAAGGATGG + Intronic
1118798671 14:69168746-69168768 CTTTCTGTACAGAGGAAGGAAGG - Intergenic
1120232646 14:81856636-81856658 CAAAATGCACAAAGCAAGGAAGG + Intergenic
1121267914 14:92616222-92616244 CAAAATGCACAAAGCAAGGAAGG + Intronic
1121565085 14:94903461-94903483 CATTTTGCAAAAAGAAAGAAGGG + Intergenic
1121565806 14:94908418-94908440 CATGCTGCTGAAAGGAAGGAAGG - Intergenic
1122162681 14:99796800-99796822 TCTCAGGCACAAAGGAAGGATGG - Intronic
1126087211 15:45021826-45021848 CATTATCCTCAAAGGAGGGAGGG + Intergenic
1126389971 15:48137386-48137408 CAGTATGTGCATAGGAAGGAAGG + Exonic
1126911569 15:53422331-53422353 CATTAGGGAGAAGGGAAGGAGGG + Intergenic
1128283652 15:66418008-66418030 CAAAATGCACAAAGCAAGGAAGG + Intronic
1129136737 15:73559822-73559844 CATAAGGCACAAACGTAGGAAGG - Exonic
1130892687 15:88146621-88146643 CATTCTGCACAAACAAAGGAAGG - Intronic
1131448433 15:92518882-92518904 TATTATGAGCAAAGGAATGATGG + Intergenic
1133950685 16:10389394-10389416 TCTTATGCCCAAGGGAAGGAGGG - Intronic
1133998772 16:10766662-10766684 CAAAACGCACAAAGAAAGGAAGG + Exonic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1138099443 16:54240681-54240703 CATTATTCCCCAAGGAAAGAAGG + Intergenic
1140906274 16:79412020-79412042 CAGTCTGCACAAGGGAAGCAAGG - Intergenic
1140943978 16:79749969-79749991 CACAGTGGACAAAGGAAGGATGG - Intergenic
1141249020 16:82338140-82338162 CCTTCTGGACAAAGGACGGATGG - Intergenic
1141780261 16:86154879-86154901 CAATCTGCATGAAGGAAGGAGGG - Intergenic
1141913045 16:87073303-87073325 CATTATTTACAGATGAAGGACGG - Intergenic
1142150235 16:88509445-88509467 CATTAGGCACACAGGGAGGCTGG + Intronic
1142171056 16:88623007-88623029 CGTTCTGCACCAAGGAGGGATGG + Intronic
1143724534 17:8836219-8836241 CATTATGGCCAAGGGCAGGATGG + Intronic
1149548449 17:57521899-57521921 CATTCTCCAAAGAGGAAGGACGG - Intronic
1151287538 17:73123849-73123871 CATTGTGCCCACAGGAAGCAGGG - Intergenic
1153148182 18:2057308-2057330 CTTTATGCAAAAAGGAAGCTGGG - Intergenic
1156704911 18:39868753-39868775 CATTCTGCAGAAAAGAATGAGGG - Intergenic
1157013152 18:43677429-43677451 CAAAACGCACAAAGGAAGGATGG + Intergenic
1157726646 18:49969565-49969587 CAAAACGCACAAAGCAAGGAAGG - Intronic
1157775964 18:50396579-50396601 CAAAATGCACAAAGCAAGGAAGG - Intergenic
1162657053 19:12139363-12139385 CAAAACGCACAAAGCAAGGAAGG - Intronic
1164882321 19:31742990-31743012 CATTATTTTTAAAGGAAGGAGGG - Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165991754 19:39819270-39819292 TAGTCTGCACAGAGGAAGGAGGG - Intergenic
1167780915 19:51598320-51598342 CATTATGCACCAAGAAGAGAAGG - Intergenic
925079387 2:1051209-1051231 CATAAAGCAAACAGGAAGGAAGG - Intronic
925358736 2:3262484-3262506 CATTATACACCTAGGAAGGCTGG + Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
925872280 2:8281777-8281799 CATTATGCTCAGAGGAAGGTGGG - Intergenic
926044763 2:9702497-9702519 CAATGTGTACAAAGGCAGGAAGG - Intergenic
926627309 2:15102970-15102992 CATTAAGGAGGAAGGAAGGAAGG + Intergenic
927051769 2:19337250-19337272 CATCATGCAGAAAGAAAGTAAGG + Intergenic
927649604 2:24904107-24904129 CAAAATGCAAAAAGGAAGGAAGG + Intronic
929766852 2:44850967-44850989 TACTATGAACAAACGAAGGAAGG + Intergenic
930191879 2:48467955-48467977 CATGATGCACAGAAGAAGCAGGG - Intronic
931706104 2:64947764-64947786 CATTATGGACAAATGAAGCAGGG - Intergenic
933540901 2:83641057-83641079 AACTAAACACAAAGGAAGGAAGG - Intergenic
937169610 2:119852358-119852380 CACACTGAACAAAGGAAGGAAGG - Intronic
938051621 2:128177978-128178000 CAAGATGCAAAAAGGAGGGATGG - Intronic
939391522 2:141574633-141574655 GATTATTCACACAGGAAGAAAGG + Intronic
939599897 2:144175594-144175616 CTTTATATAGAAAGGAAGGAAGG - Intronic
942728593 2:179038175-179038197 CATTATTCAAAAAGGAATGAAGG + Intronic
942756135 2:179343703-179343725 CAAAACGCACAAAGCAAGGAAGG + Intergenic
943013378 2:182479866-182479888 CTTTATGTACATAGGAAGAAAGG + Intronic
943118214 2:183701311-183701333 CATTATACACATATTAAGGAAGG + Intergenic
945200430 2:207275609-207275631 AATTATACACAGTGGAAGGAAGG - Intergenic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
948471024 2:238179254-238179276 AGTGATTCACAAAGGAAGGATGG + Intronic
1169747046 20:8953161-8953183 TGTTATGCACTCAGGAAGGATGG - Intronic
1170086167 20:12534845-12534867 CATTATGCATAATGATAGGAGGG + Intergenic
1173066276 20:39715496-39715518 CAGTAAGCACAAAGGAATAAGGG - Intergenic
1176674484 21:9765511-9765533 AATGATGGACAATGGAAGGAAGG + Intergenic
1176674513 21:9765785-9765807 AATGATGGACAATGGAAGGAAGG + Intergenic
1176674519 21:9765831-9765853 GATGATGGACAATGGAAGGAAGG + Intergenic
1176674524 21:9765877-9765899 AATGATGGACAATGGAAGGAAGG + Intergenic
1177469595 21:21542213-21542235 AATTTTTCAAAAAGGAAGGATGG - Exonic
1177533594 21:22396520-22396542 CAAAACGCACAAAGCAAGGAAGG - Intergenic
1178675845 21:34631219-34631241 CTTTCTGCACTCAGGAAGGAGGG - Intergenic
1178723299 21:35029152-35029174 CATCAGGCAGAAAGGAAGAAGGG - Intronic
1178725054 21:35044103-35044125 CTTTTTCCACAAGGGAAGGAAGG + Intronic
1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG + Intronic
1179118606 21:38520608-38520630 CAACATGCACAAAGGAAAGCTGG + Intronic
1179418081 21:41214368-41214390 CATTATGCACACATCACGGATGG - Intronic
1184022067 22:41827463-41827485 CAAAATGCACAAAGCAAGGAAGG + Intergenic
1184414491 22:44344353-44344375 CAGGAAGCACAAAGGAAGCAGGG - Intergenic
1184740476 22:46426015-46426037 CATTATTCAAAAAAGAAGGGAGG - Intronic
1184974954 22:48054532-48054554 CATTGCACAGAAAGGAAGGAAGG + Intergenic
949243846 3:1902229-1902251 CATTAGGAAGGAAGGAAGGAAGG + Intergenic
949899799 3:8801976-8801998 CAATTTGCCCAAAGGAAGGAAGG + Intronic
952624579 3:35389051-35389073 CATTATGCACTAAAGACGAATGG + Intergenic
953272841 3:41462486-41462508 CATTATGCTGTAAGGCAGGAAGG - Intronic
954767246 3:52929633-52929655 GATTATTCTCAAAGCAAGGAGGG - Intronic
956737725 3:72251220-72251242 CACAAGGAACAAAGGAAGGATGG + Intergenic
957159677 3:76594402-76594424 AATAAAGCACAAAGGAAGAAGGG + Intronic
957297142 3:78346619-78346641 CAAAACGCACAAAGCAAGGATGG - Intergenic
960713563 3:120555070-120555092 AATTAAGCAGCAAGGAAGGAAGG - Intergenic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
963207549 3:142652016-142652038 CATTATGGACACATTAAGGAAGG + Intronic
965251924 3:166353230-166353252 CATTCAGCACAAAAGAAAGATGG + Intergenic
965534939 3:169813770-169813792 CAAAACGCACAAAGCAAGGAAGG - Intergenic
965631802 3:170740817-170740839 CACTATATACAAAGGAAAGAAGG + Intronic
967553232 3:190824362-190824384 CATTACGCAGAAAGGAAGTGGGG - Intergenic
968386070 4:139629-139651 CAAAACGCACAAAGCAAGGAAGG - Intronic
968386552 4:144230-144252 CAAAATACACAAAGCAAGGAAGG - Intronic
968594786 4:1476727-1476749 GATTGTGCAAGAAGGAAGGATGG - Intergenic
968801791 4:2747674-2747696 CAGCATGCACAAAGGAATGTGGG - Exonic
969735038 4:8982506-8982528 CAATATTCACAAAGGAAATACGG - Intergenic
974189606 4:58488138-58488160 CAAAATGCACAAAACAAGGAAGG + Intergenic
975021420 4:69495273-69495295 CAACAGGCACATAGGAAGGAGGG + Exonic
975584354 4:75935931-75935953 AATTATGCTTATAGGAAGGACGG - Intronic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
976656216 4:87491524-87491546 CAGCATTCACAAAGGATGGAGGG + Intronic
976951065 4:90831201-90831223 CATTATGGAGAAAGGAAGGTAGG + Intronic
977151979 4:93523848-93523870 CATGTTGCACAAAGGAAAAAAGG + Intronic
977865180 4:102016935-102016957 CATTCTGTAAAAAGAAAGGAGGG + Intronic
978453930 4:108867269-108867291 CATGATACACAAAGAAAGGGCGG - Intronic
978941979 4:114447846-114447868 CATTTTGAAAGAAGGAAGGAAGG + Intergenic
980301854 4:131006494-131006516 CAAAACGCACAAAGCAAGGAAGG + Intergenic
981252561 4:142621679-142621701 CATTATTCAGCAAGGTAGGAAGG - Intronic
982634435 4:157875107-157875129 CCTTAAGAACAGAGGAAGGATGG - Intergenic
982762931 4:159309034-159309056 CAGTAAGCACAAAGAAAGCAAGG + Intronic
982895032 4:160909651-160909673 CATTATGCATAAAGCAGGCAAGG + Intergenic
984600498 4:181721142-181721164 CATTATGTACAAAGGCAGAGAGG + Intergenic
985400766 4:189591557-189591579 GATGATGGACAATGGAAGGAAGG - Intergenic
985400772 4:189591603-189591625 AATGATGGACAATGGAAGGAAGG - Intergenic
985400808 4:189591862-189591884 AATGATGGACAATGGAAGGAAGG - Intergenic
985400822 4:189592001-189592023 AATGATGGACAATGGAAGGAAGG - Intergenic
987270192 5:16299899-16299921 CATTAGGAAGAAAGGAAGGAAGG - Intergenic
987842344 5:23237550-23237572 CAAAACGCACAAAGCAAGGAAGG + Intergenic
988206448 5:28142531-28142553 CAATATGCACAAAGCAATGATGG + Intergenic
991361033 5:65820537-65820559 CATTTTGACCAAAGAAAGGAAGG + Intronic
991978249 5:72204166-72204188 CATAAAACACAAAGGAAGAAAGG - Intronic
992068536 5:73129094-73129116 CAAAATGCACAAACGAAGCAAGG + Intronic
992151126 5:73904292-73904314 CATTATCCACAAATAAAGGCTGG - Intronic
993113727 5:83692397-83692419 CATTATTCACAGAGGAATAAAGG + Intronic
994200587 5:96970782-96970804 AATTAAGCAGAAAGGAAGAAGGG - Intronic
995020760 5:107364937-107364959 CTTAATTCACAAAGGAAGCATGG - Intergenic
996028086 5:118673516-118673538 CCTTAATCACAAAGGAAGAAAGG - Intergenic
996856609 5:128015235-128015257 CATTTCACACAATGGAAGGAAGG + Intergenic
997581191 5:135018503-135018525 CCAAATGCACAAAGGAAAGATGG + Intergenic
997768908 5:136534448-136534470 CATCCTGCAGGAAGGAAGGAGGG - Intergenic
998002390 5:138635343-138635365 CATTTTGCCCAGAGCAAGGAAGG - Intronic
1002670038 5:180859363-180859385 CAAAATGTACAAAGGAAAGATGG + Intronic
1004444171 6:15682796-15682818 CATCAGCCAAAAAGGAAGGATGG + Intergenic
1004533719 6:16478842-16478864 CCAGATGCACAAAGGAAGGCTGG + Intronic
1005099355 6:22153469-22153491 CAATATGTAAAAAGGAAGAATGG + Intergenic
1007336026 6:41155758-41155780 CCTTGTTCCCAAAGGAAGGAAGG - Intergenic
1010424374 6:75710496-75710518 GATTAAGCAAAAAGGAAAGATGG - Intronic
1011381574 6:86747533-86747555 CAATATGAACTACGGAAGGATGG - Intergenic
1013453941 6:110312814-110312836 CAAAATGCACAAACAAAGGAAGG + Intronic
1013807441 6:114011221-114011243 CGAAATGCACAAAGCAAGGAGGG + Intronic
1013936186 6:115597760-115597782 CATTATGCAAATTGAAAGGAAGG - Intergenic
1015017516 6:128431959-128431981 CCCAATGCAAAAAGGAAGGAAGG + Intronic
1015974434 6:138774905-138774927 CACTATGCACAAATAAAGTATGG + Intronic
1017207836 6:151823189-151823211 CATTAAGCAGAAAGGCAGCATGG - Intronic
1017385571 6:153878899-153878921 CATGAAGAACAAATGAAGGAAGG + Intergenic
1017781591 6:157719680-157719702 AGTGATGCTCAAAGGAAGGACGG + Intronic
1020218949 7:6219367-6219389 TATTATGCAAAAAGGAACCAGGG + Intronic
1022498665 7:30868981-30869003 CAATAAGCACAAAGGAGAGATGG - Intronic
1023817280 7:43960865-43960887 CAAAATGCACAAAGAAAGCAAGG + Intergenic
1024036769 7:45513366-45513388 CATCATGTAGAAAGGAAGGAAGG - Intergenic
1024599157 7:50964359-50964381 CAAAATGCACAAAGCAAGGAGGG - Intergenic
1024943377 7:54784766-54784788 GATTATCCACCAAGGAATGATGG + Intergenic
1026403281 7:70038274-70038296 CATTGTTTACAAATGAAGGAGGG + Intronic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1027530824 7:79330078-79330100 CATTATCCAAATAGGAAGAAAGG + Intronic
1027780774 7:82517307-82517329 GATTATGGACAAAGAGAGGAAGG + Intergenic
1027916428 7:84329190-84329212 CATTATGTATAAAGGCATGAAGG + Intronic
1029250612 7:99233517-99233539 CATCACGCACCAAGGAAGGCAGG - Intergenic
1029325807 7:99807870-99807892 CCTAAGGCACAAAGGAAAGAGGG - Intergenic
1029790119 7:102834027-102834049 CATGATGAAGGAAGGAAGGAAGG + Intronic
1030644853 7:112048611-112048633 CATTAAGTACAGAGGAAGAAAGG + Intronic
1031094071 7:117398207-117398229 CAAAATGCACAAAGTAAGAAAGG - Intronic
1031670211 7:124533599-124533621 CATGGTGGACAAAGGAAGGGAGG + Intergenic
1031819562 7:126483175-126483197 CATGATGAAGGAAGGAAGGAAGG - Intronic
1031819590 7:126483476-126483498 CATGATGAAGGAAGGAAGGAAGG - Intronic
1031997999 7:128245520-128245542 AGTTATGAAGAAAGGAAGGAAGG + Intronic
1033006494 7:137570114-137570136 CCTTATGCATAAAAGAAAGAAGG - Intronic
1033441137 7:141379792-141379814 CATAATGAAGAAAGGAAGAAAGG - Intronic
1034458169 7:151182946-151182968 GTTTACTCACAAAGGAAGGAAGG + Intronic
1038355414 8:26824610-26824632 CATTGAGCAAAAAGGGAGGAAGG - Intronic
1039287402 8:36057147-36057169 GATTATTCCCACAGGAAGGAGGG - Intergenic
1040614779 8:49023794-49023816 AAATATGAAGAAAGGAAGGAGGG - Intergenic
1040614945 8:49025727-49025749 CTGCATGCAGAAAGGAAGGATGG + Intergenic
1041650079 8:60293726-60293748 CATTATGCAAAAAGGCATGGTGG - Intergenic
1041828105 8:62121409-62121431 CAAAATGCACAAAGCAAGGAAGG + Intergenic
1042148934 8:65760773-65760795 TATTATGGGGAAAGGAAGGAGGG + Intronic
1043449002 8:80348236-80348258 CAGTATGCCCCAAGGAAAGATGG - Intergenic
1044733399 8:95251586-95251608 AATTCTGAACAAGGGAAGGATGG + Intronic
1046019705 8:108649990-108650012 CCTTATACAGAAAAGAAGGATGG - Intronic
1046577670 8:116051326-116051348 GGGAATGCACAAAGGAAGGAGGG - Intergenic
1047016280 8:120726974-120726996 CATAATGCAAAAAGAAAGGAGGG - Intronic
1047801757 8:128317396-128317418 CATTAAGTACAAAGGTATGAAGG - Intergenic
1047886707 8:129259166-129259188 CAATATACACAATGGGAGGAGGG + Intergenic
1048457073 8:134587853-134587875 TATTATGAATGAAGGAAGGAGGG - Intronic
1050139406 9:2501978-2502000 CAAAATGCACAAAACAAGGAAGG + Intergenic
1050701327 9:8342941-8342963 TAGTATGAACAAAGGACGGATGG + Intronic
1050714355 9:8505044-8505066 CTTTATTCACAAAGAAAGTAAGG - Intronic
1052433063 9:28392289-28392311 CAATATGCATGAGGGAAGGAAGG + Intronic
1053090388 9:35270046-35270068 TATTTTGTACTAAGGAAGGAAGG - Intronic
1055354760 9:75426463-75426485 AACTAGGCAGAAAGGAAGGAAGG + Intergenic
1055817540 9:80224615-80224637 CAGTATTCACAAAAGCAGGAAGG + Intergenic
1055824541 9:80307259-80307281 CCTGAAACACAAAGGAAGGAAGG - Intergenic
1056263057 9:84868175-84868197 CCTTATTCACATATGAAGGAAGG - Intronic
1058901699 9:109447755-109447777 CATTGTGCACAAGGGAAGACTGG - Intronic
1058971573 9:110088059-110088081 CAAAATGCACAAACAAAGGAAGG + Intronic
1059606000 9:115836719-115836741 CATTATGCACAGAGGATAAAAGG + Intergenic
1186679717 X:11859504-11859526 CATTTTGCATAAAGTAAGGAAGG + Intergenic
1187162159 X:16774701-16774723 CAAAACGCACAAAGCAAGGAAGG + Intergenic
1188277042 X:28213054-28213076 CATTAGGCAGTATGGAAGGATGG - Intergenic
1188322428 X:28756275-28756297 CATTATAGTGAAAGGAAGGAAGG - Intronic
1188451362 X:30310572-30310594 CATTATTCACTTAGGAAGGGTGG - Intergenic
1189418127 X:40832584-40832606 CAGCATGCACAAAGGAACGTGGG - Intergenic
1191863070 X:65681750-65681772 TGTGAGGCACAAAGGAAGGAAGG + Intronic
1191997446 X:67110992-67111014 CATAATGTTCAAAGTAAGGAAGG + Intergenic
1192399629 X:70821840-70821862 CATTATGCAAAATAGTAGGAAGG + Intronic
1192418932 X:71011114-71011136 CAAAATGCACAAAGTTAGGAAGG - Intergenic
1192773955 X:74222559-74222581 CCAGATGCAGAAAGGAAGGAAGG + Intergenic
1195861703 X:109390007-109390029 CAGCCTGCACACAGGAAGGAAGG + Intronic
1195887450 X:109654889-109654911 CATTAGGTACAACAGAAGGAGGG + Intronic
1196420237 X:115513696-115513718 CAAAACGCACAAAGCAAGGAAGG - Intergenic
1198812603 X:140550834-140550856 CTCTGTGCACAAAGGAAGGTTGG + Intergenic
1199134961 X:144238249-144238271 CATTATACAAAAGGGGAGGAGGG + Intergenic
1199681478 X:150227617-150227639 GTTTGGGCACAAAGGAAGGAGGG + Intergenic
1200745095 Y:6897214-6897236 CATGATGCACAGAAGAATGATGG + Intergenic