ID: 1072381233

View in Genome Browser
Species Human (GRCh38)
Location 10:94873073-94873095
Sequence CAGTGAAAGGAGAAGCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 8, 3: 69, 4: 518}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072381230_1072381233 -5 Left 1072381230 10:94873055-94873077 CCCAGAGATCTGTGTTCACAGTG 0: 1
1: 0
2: 2
3: 26
4: 243
Right 1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG 0: 1
1: 0
2: 8
3: 69
4: 518
1072381228_1072381233 1 Left 1072381228 10:94873049-94873071 CCCTCTCCCAGAGATCTGTGTTC 0: 1
1: 0
2: 2
3: 31
4: 272
Right 1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG 0: 1
1: 0
2: 8
3: 69
4: 518
1072381229_1072381233 0 Left 1072381229 10:94873050-94873072 CCTCTCCCAGAGATCTGTGTTCA 0: 1
1: 1
2: 1
3: 25
4: 210
Right 1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG 0: 1
1: 0
2: 8
3: 69
4: 518
1072381231_1072381233 -6 Left 1072381231 10:94873056-94873078 CCAGAGATCTGTGTTCACAGTGA 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG 0: 1
1: 0
2: 8
3: 69
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072381233 Original CRISPR CAGTGAAAGGAGAAGCAAAC AGG Intergenic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
903253744 1:22076799-22076821 AAGGGAAAGGAGAAGGAAAAAGG + Intronic
903623731 1:24716309-24716331 CAATGCAAGGAGAAGCAGAGAGG + Intergenic
904139506 1:28341266-28341288 CACTGCAAGGAGAAGAAAGCTGG - Intergenic
906352982 1:45079650-45079672 AAGTGAAAGTAAAAGCAAAGGGG - Intronic
906838511 1:49110140-49110162 CATTGAAGGGAGGAGAAAACAGG - Intronic
907281030 1:53347123-53347145 GGGTGAAGGGAGAAGCAAACTGG + Intergenic
908254295 1:62290289-62290311 CATTGAAGGGAGAATTAAACAGG - Intronic
908600355 1:65732163-65732185 CAGAGAAAGGAGGAGCAAAAGGG - Intergenic
908763228 1:67531360-67531382 TGGTGGAAGGGGAAGCAAACAGG + Intergenic
908887193 1:68802972-68802994 CAGTCAAAGCAAAGGCAAACTGG + Intergenic
908933805 1:69348878-69348900 CAGTGAAAGGAGAGGAAAAATGG + Intergenic
909415191 1:75398426-75398448 CAATGAGAGGAGAAGGGAACTGG + Intronic
910035009 1:82778694-82778716 CAGTGAAAGAAAAAGCAATTCGG - Intergenic
910046952 1:82929072-82929094 CAGTGAAAAGCGAAACACACTGG - Intergenic
911169314 1:94754641-94754663 CAGGGAATGGAAGAGCAAACTGG - Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
912728809 1:112083028-112083050 CTTTGAAAGGAGGAACAAACAGG + Intergenic
912890002 1:113519968-113519990 CAGTGAAAAGACAATAAAACAGG - Intronic
914341735 1:146765844-146765866 CAATTAAAGGAGAAGAGAACCGG + Intergenic
914758549 1:150580267-150580289 CAGAGATGGGAGAAGCAAGCAGG - Intergenic
915844322 1:159247762-159247784 TAGTGAGGGGAGAAGCAAAGAGG + Intergenic
916765421 1:167855522-167855544 AAGTGACAGGAAAGGCAAACTGG - Intronic
916889890 1:169105249-169105271 CAGTGGAAGCAGAAGCATCCCGG + Intergenic
916986956 1:170201990-170202012 CAGTGAGATGAGAAGAAATCAGG - Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918402945 1:184181916-184181938 CAGTGAATGGATAAGTAAAATGG + Intergenic
919512251 1:198479965-198479987 CAATGAAAGGAAAAGAAAATTGG - Intergenic
919670863 1:200336796-200336818 CAGTAAAAGTGGAAGTAAACTGG - Intergenic
920056534 1:203196919-203196941 CTGTGAAGGCAGAAGCAAGCCGG - Intergenic
920110647 1:203584761-203584783 CAGAGGGAGGAAAAGCAAACAGG + Intergenic
921015044 1:211181910-211181932 CAGTAAAAGTAGAAGAAAACCGG + Intergenic
921101738 1:211934445-211934467 CAGTGAAAGGAGAAAGGAATGGG - Intergenic
921493013 1:215802229-215802251 CACTGAAAGCAGAAGCAATAAGG + Intronic
921633577 1:217464611-217464633 CAGTGGAAGTAGAAGCGAACTGG + Intronic
921938675 1:220817696-220817718 CAGTGAGAGGTGAAGCCAGCTGG - Exonic
922886094 1:229021870-229021892 CAGTGAGAGAAGAAGGACACTGG + Intergenic
922951931 1:229565721-229565743 CGGTGAATGGATAAACAAACTGG - Intergenic
923563441 1:235059242-235059264 CAGATAAAGGAAATGCAAACTGG + Intergenic
924715261 1:246566835-246566857 CTGAGAAAGGAGAGGAAAACAGG - Intronic
1063080315 10:2761550-2761572 CTGTGAAAAGAAAAGCACACAGG + Intergenic
1063245768 10:4216654-4216676 CAAAGAAAGGAAAACCAAACAGG + Intergenic
1063817047 10:9787402-9787424 TATTGGAAGGTGAAGCAAACAGG - Intergenic
1064144761 10:12818786-12818808 CACTGGAAGGAGAAGAAAAGGGG + Intronic
1064219429 10:13427970-13427992 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1064694360 10:17950701-17950723 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1066541305 10:36449625-36449647 GTGTGAAAGGAGATGCAAATAGG + Intergenic
1066987689 10:42482635-42482657 CAGTGAAAAAAAAAGAAAACTGG - Intergenic
1067049743 10:43007652-43007674 CAGTGAAAGGAGTGGTAAAGGGG - Intergenic
1067362876 10:45598120-45598142 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1067724573 10:48760284-48760306 CAGTGAAAATAGAAAGAAACTGG + Intronic
1067926157 10:50510264-50510286 TAGTGAATGGATAAACAAACTGG - Intronic
1069071375 10:63993545-63993567 CACTTAAAGGAGAAGGAAAGAGG - Intergenic
1069287391 10:66732524-66732546 TGGTGGAAGGAGAAGCAAACAGG + Intronic
1069402252 10:68061576-68061598 CAGCGAAAGAATAAGCAAATGGG + Intronic
1069484425 10:68812455-68812477 CAGTGAAAGGAGAGACAAGTGGG + Intergenic
1069694400 10:70376213-70376235 CAGTCAAAGGACAAGCAGGCAGG + Intronic
1070123947 10:73605176-73605198 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
1070442801 10:76463278-76463300 CAGTGAAATGAGATGCAAGTGGG + Intronic
1070559348 10:77554052-77554074 GAGTGGAAGGAGAAGCCCACAGG + Intronic
1070699577 10:78591288-78591310 CAGTGAACAAAGAAGGAAACAGG + Intergenic
1070714813 10:78711739-78711761 GAGGGAAAAGAGAAGCAAACCGG - Intergenic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1071971484 10:90912215-90912237 CAGTGGAAGGAGCGGCAAACTGG - Exonic
1072363465 10:94683854-94683876 GAGTGAAAGGAGAAACAAACAGG - Exonic
1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG + Intergenic
1072384103 10:94905932-94905954 GAGTGAAAGGAGAAACAAACAGG - Intergenic
1073105092 10:101028153-101028175 CAGTCAGAGGAGAAGCCAAGTGG + Intronic
1073674464 10:105629974-105629996 CAGTGAAAGAAAAAAAAAACAGG - Intergenic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074674336 10:115831164-115831186 TAGGGAAAAGGGAAGCAAACCGG - Intronic
1074966257 10:118493298-118493320 GGGTGAAAGGAGAGGCAGACAGG - Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075312247 10:121424195-121424217 CAGTGGAAAGAGAACTAAACTGG - Intergenic
1075371705 10:121941957-121941979 AGGTGAAAGGATAAACAAACTGG + Intergenic
1076231164 10:128821130-128821152 CAGTCAAAGGATAACCACACTGG + Intergenic
1077792026 11:5451315-5451337 AAGAGAAGGGAGAAGAAAACAGG - Intronic
1077825577 11:5805388-5805410 CAGTGAAAGGGATAGCCAACTGG + Intronic
1078317054 11:10303069-10303091 AAGTGAAAGGAAAAGGAAATGGG + Intergenic
1078420092 11:11204192-11204214 CAGGGAAATGAGATGAAAACTGG - Intergenic
1078682661 11:13492859-13492881 CACTAAAAGGACAAGCAAAATGG + Exonic
1079093375 11:17495738-17495760 CAGTGAAAGGAGAAGCCCCATGG - Intronic
1079591174 11:22184838-22184860 CAGTGTACGGATAAGAAAACTGG + Intergenic
1080141233 11:28922798-28922820 CAGATAAGGGGGAAGCAAACTGG - Intergenic
1080182427 11:29441516-29441538 CGGTGAAAGCAGAAGCAAACAGG + Intergenic
1081286308 11:41274523-41274545 CATTGAGAGGTGAAGCCAACTGG + Intronic
1081322597 11:41709418-41709440 CTGTAAAAAGAGAAGCAAAGGGG - Intergenic
1081373975 11:42337961-42337983 CAGTGAAAAGAGAAGCCATATGG - Intergenic
1081909549 11:46692177-46692199 CAGTGGAAGGAAAAGCAGACTGG + Intronic
1083552378 11:63599512-63599534 CTGTGAAATAATAAGCAAACTGG - Intronic
1083594824 11:63914174-63914196 CAGTGAAAGGAGAGGCAGGTAGG + Intronic
1084890958 11:72237039-72237061 CAGTGGAAGGAGAACTAGACGGG - Intronic
1085132258 11:74050838-74050860 CACTGAAAGCACAAGTAAACTGG + Intronic
1085463033 11:76706701-76706723 CAGTCCAAGGAGACGCACACAGG - Intergenic
1085794977 11:79530960-79530982 AGGTGAAAAGAGAAGGAAACTGG - Intergenic
1086092566 11:83019564-83019586 CCCTGAAGGAAGAAGCAAACTGG - Intronic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1087321121 11:96660041-96660063 AAGTGAAAGGAAAAGAAAAATGG + Intergenic
1087637766 11:100721823-100721845 AAGTGAATGGATAAGCAAACTGG - Intronic
1088003801 11:104916024-104916046 CAGTGTGAGAAGAAGCAAAAAGG + Intergenic
1088177503 11:107070531-107070553 AAGGGAAAGGGGAAGCCAACTGG + Intergenic
1088362019 11:109001246-109001268 AAGTGGAAGGAAAAGCAAAAGGG - Intergenic
1088737459 11:112739657-112739679 CAGGGAAAGAAGAAGCCCACAGG - Intergenic
1088840125 11:113619832-113619854 CAGTCAAAGTAAAAGCAGACTGG + Intergenic
1089078312 11:115756633-115756655 CAGAGAAAGGATAAGCATTCGGG - Intergenic
1089609194 11:119660186-119660208 CAGTGAAAGGAGATGCTACTGGG + Intronic
1089690554 11:120184443-120184465 GAGCGAAAGGAGAAACAGACAGG - Intronic
1090702697 11:129310706-129310728 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1091073513 11:132591970-132591992 CAGTGAGAGGAGATGAACACTGG + Intronic
1091679542 12:2516992-2517014 CAGGGAAAGAACCAGCAAACAGG + Intronic
1091757130 12:3061177-3061199 CAGTGAAATGAGCAGCACATTGG + Intergenic
1091949039 12:4576390-4576412 CAGTGAATGGATAAGCAAACTGG - Intronic
1092910598 12:13141649-13141671 CAGTGGAAGGGGAAAAAAACTGG - Intronic
1092916892 12:13197396-13197418 AAGTGAATAGGGAAGCAAACAGG - Intronic
1093656980 12:21706203-21706225 GAGTGAATGCATAAGCAAACTGG - Intronic
1095621505 12:44260814-44260836 CAGTGAGAGGAGAGGCAGATGGG + Intronic
1095898832 12:47306616-47306638 CAGTGAAAGGTGAAGCCTGCTGG + Intergenic
1096751029 12:53758996-53759018 CAGGGAGAAGAGAAGCAAAAAGG - Intergenic
1096884799 12:54706476-54706498 CAGGGCAAGGAGAAGCAATGAGG - Intergenic
1097146217 12:56941129-56941151 CAGAGAGAAGAGAAACAAACAGG + Intergenic
1097151934 12:56985606-56985628 CAGAGAGAAGAGAAACAAACAGG + Intergenic
1097158963 12:57032132-57032154 CAAAGAAAGGAGAGGCAATCCGG - Intronic
1097950912 12:65427466-65427488 CAGTGAAAGAAAAAGAAATCAGG - Intronic
1098477459 12:70921248-70921270 GAGTGGAAAGAGAAGCAAAGAGG - Intergenic
1099451172 12:82808680-82808702 CAGTGGCAGGAGAAGAATACTGG - Intronic
1099544806 12:83965201-83965223 CAAAGAAAGGGGAAGCAAACAGG + Intergenic
1100010587 12:89948006-89948028 CAGAGAAAGGATTAGCAAACAGG + Intergenic
1100282719 12:93133531-93133553 CAGTCAAAGAAAAAGCAGACTGG + Intergenic
1102387593 12:112523002-112523024 CAGTCAAAGCAAAAGCAGACCGG + Intergenic
1102661662 12:114534258-114534280 CACTTTAAGGAGAAGAAAACAGG - Intergenic
1103066271 12:117900455-117900477 AAGGGAAAGGAGAATAAAACAGG + Intronic
1103100572 12:118170872-118170894 CATTGAAATGAGAAGGAAAAAGG - Intronic
1103742767 12:123102481-123102503 AACTGAAAGAAAAAGCAAACTGG + Intronic
1104114987 12:125741000-125741022 GAGTGAAAGTATAAGCAAAAAGG - Intergenic
1105227243 13:18447533-18447555 AAGGCAAAGGAGAAGCACACTGG - Intergenic
1105272552 13:18891941-18891963 CAGCAAAAGGAGAAGCAAAGGGG + Intergenic
1105520951 13:21130455-21130477 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1105995526 13:25667792-25667814 CAGTGAAAAGGGAATCAAAAGGG - Intronic
1106178470 13:27351223-27351245 CAGTGAGAGGTGAAGCCACCTGG - Intergenic
1106915283 13:34507208-34507230 CAGAGAAAGAAGAAGAAAAATGG - Intergenic
1106927113 13:34624366-34624388 CACTAAAAGGAGAAGAAGACGGG + Intergenic
1106938761 13:34753272-34753294 CACTGAGAGGTGAAGCCAACTGG + Intergenic
1106948409 13:34854795-34854817 AAGTGTAAGGAGAAGCCAAAGGG - Intergenic
1107036725 13:35910007-35910029 AAGACAAAGGAGAAGCAAAGCGG - Intronic
1107811459 13:44204358-44204380 GAGTGAATGGTTAAGCAAACTGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108515686 13:51200558-51200580 GATTGAAAGGTGAAGCCAACTGG - Intergenic
1108726243 13:53184553-53184575 TGGTGGAAGGGGAAGCAAACAGG + Intergenic
1108817814 13:54313268-54313290 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1109138824 13:58687805-58687827 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1109163836 13:59009157-59009179 TAGTGAGAGGTGAAGCCAACTGG + Intergenic
1109556870 13:63987536-63987558 AAGAGAAAGGAGAAGAAAAGTGG - Intergenic
1109641428 13:65196766-65196788 CAATGAAATGAGAATCAGACTGG + Intergenic
1109680343 13:65744198-65744220 GTTTGAAAGGAGAAGCAAAAGGG - Intergenic
1110079274 13:71290357-71290379 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1110367341 13:74701623-74701645 CAGTGAAATGAGGAACAAGCAGG + Intergenic
1111006150 13:82251979-82252001 ATATGAAAGGACAAGCAAACAGG + Intergenic
1111197523 13:84894592-84894614 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1111425981 13:88082917-88082939 CAGGGAAAAGTGAAGCAACCAGG + Intergenic
1113242680 13:108355989-108356011 CAGTCAAAGCAAAAGCAGACAGG - Intergenic
1113761133 13:112847273-112847295 CAGCGAAAGGAGAAATTAACTGG - Intronic
1114011694 14:18375987-18376009 AAGGCAAAGGAGAAGCAAACTGG - Intergenic
1114851876 14:26391972-26391994 CAGTGAAATGGGAAGCTCACTGG - Intergenic
1116050254 14:39794160-39794182 TGGTGGAAGGGGAAGCAAACAGG + Intergenic
1117313435 14:54551032-54551054 CACAGGAATGAGAAGCAAACAGG - Intergenic
1118049688 14:62013501-62013523 CAGTGAATGAAGAAGCAGGCAGG - Intronic
1118088765 14:62448641-62448663 CTGGCAAAGCAGAAGCAAACAGG - Intergenic
1118500280 14:66355896-66355918 TAGTGCAAAGAGAACCAAACTGG - Intergenic
1118704934 14:68471794-68471816 CAGACAAAGGAGATGCAAACAGG - Intronic
1118844685 14:69538503-69538525 CACTGAAATGAGAAGCCCACTGG + Intergenic
1119678844 14:76576683-76576705 CACTGAAAGGAGCAGGGAACAGG + Intergenic
1120806358 14:88755339-88755361 CAGTGAAAGGAATAGTAAAATGG - Intronic
1121139248 14:91526405-91526427 CAGAGAAAGGAAAACTAAACAGG - Intergenic
1121495423 14:94388690-94388712 CAGTTATCGGAGGAGCAAACAGG + Intronic
1121744146 14:96274863-96274885 CAGTGAAGGGAAAATCACACTGG - Intergenic
1121827337 14:97021130-97021152 CAGTGACAGGGAAAGCACACAGG + Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1124198693 15:27657478-27657500 CAGTGAAAGAAGAAACCATCTGG + Intergenic
1124613734 15:31226454-31226476 CACTGAAAGGTGAAGCCAGCGGG - Intergenic
1125356612 15:38823032-38823054 TGATGAAAGGGGAAGCAAACAGG - Intergenic
1125681123 15:41530818-41530840 CAGTAACAGGACAAGAAAACAGG + Intronic
1125681744 15:41535089-41535111 CAGTGAGTGGAGAAGCCACCTGG - Intronic
1126088001 15:45026879-45026901 CAGTTAAAGGACAAGTAAAGTGG - Intronic
1127486613 15:59423966-59423988 CAGTGAAAGGAGCAGACAAATGG - Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1128745805 15:70113467-70113489 CAGTTAAAGAGGAAGCAGACAGG - Intergenic
1129320097 15:74769953-74769975 AAGTGAAAGCAGAAGCAAGGGGG - Intergenic
1129793610 15:78359660-78359682 AAGGGAAAGAAGAACCAAACAGG + Intergenic
1130197114 15:81790204-81790226 CAATGAAAGAAGAAGCCAAAGGG + Intergenic
1130361092 15:83186981-83187003 CAATGAAAGGAGAAAAAAAATGG + Intronic
1130458116 15:84135214-84135236 CAGTTAAAGAAGGAGCAAAATGG + Intergenic
1130541850 15:84826253-84826275 CTGTGGAAGCAGAAGCAAACAGG - Intronic
1130608670 15:85340447-85340469 CAGAAACAGGAGAAGAAAACAGG + Intergenic
1131082248 15:89546454-89546476 TTGTGAAAGGAGAAGAAAAAGGG - Intergenic
1131808269 15:96146122-96146144 CAGAGGAAGCAGAAGCAAAGGGG - Intergenic
1132116812 15:99143038-99143060 AAGTGAAAAGAGATGCAAAGGGG + Intronic
1135207833 16:20498021-20498043 CATCCAAAGGAGAAGTAAACAGG + Intergenic
1135211066 16:20525679-20525701 CATCCAAAGGAGAAGTAAACAGG - Intergenic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1138000649 16:53275605-53275627 TAGAGAATGGAGAAGAAAACTGG - Intronic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138300667 16:55926848-55926870 CAGTCAAAGCAAAAGCAGACTGG - Intronic
1139200906 16:64976078-64976100 CAGTGAAAGAAAAAGCAAATGGG + Intronic
1139852857 16:69961399-69961421 CAGGGAGAAGAGAAGCAGACGGG + Intronic
1139881828 16:70184307-70184329 CAGGGAGAAGAGAAGCAGACGGG + Intronic
1139992544 16:70951598-70951620 CAATTAAAGGAGAAGAGAACCGG - Intronic
1140082858 16:71766288-71766310 CATTGAAAAGACAAGAAAACAGG - Intronic
1140370682 16:74411199-74411221 CAGGGAGAAGAGAAGCAGACGGG - Intronic
1140858145 16:78996027-78996049 CACTGAAAGAAGAGGGAAACTGG + Intronic
1141457916 16:84156494-84156516 CAACAAAAGGAGAAGCAAGCAGG - Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1144295253 17:13868766-13868788 CATTCAAAGGAGGAGGAAACAGG - Intergenic
1144471249 17:15543331-15543353 CACTGTAAGGATAAGCAAAATGG + Intronic
1144925217 17:18801362-18801384 CACTGTAAGGATAAGCAAAATGG - Intronic
1145803780 17:27711909-27711931 GAGTGAGAGGTGAAGCCAACTGG + Intergenic
1146012284 17:29205616-29205638 CAGAGAAAGGAGGGGCAAAGAGG - Intergenic
1146366368 17:32231937-32231959 CAGTGGAAGGAGTACCAAACTGG - Intronic
1148503026 17:48106451-48106473 CAGAGAAAGGGGAAGCACATAGG + Intronic
1148505246 17:48122020-48122042 CAGTGAAAGAAAAAGCAAGGAGG - Exonic
1148807764 17:50272852-50272874 CAGAGAGAGGAGAAACAGACGGG + Intronic
1150135986 17:62695370-62695392 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150672876 17:67217313-67217335 CATTGAAAATAGAAGCAATCAGG - Intronic
1151106520 17:71622399-71622421 CTGTGACAGGAGATGGAAACTGG - Intergenic
1151463093 17:74267017-74267039 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1154464335 18:14629524-14629546 CGGCAAAAGGAGAAGCAAAAGGG + Intergenic
1154526132 18:15291942-15291964 AAGGCAAAGGAGAAGCAAACTGG + Intergenic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155683178 18:28514934-28514956 AAGTGAAAGTGGAAGCAGACAGG - Intergenic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1157410590 18:47459727-47459749 CAGAGAAGGGGGAAGTAAACTGG + Intergenic
1157687009 18:49650807-49650829 CAGTGAAAGGAGAAGACCTCAGG - Intergenic
1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG + Intergenic
1157914544 18:51651900-51651922 CAGGGAAAGCAGAAGCTCACAGG + Intergenic
1159810720 18:73015428-73015450 CACTGAAAGGAGAAGCTAGCAGG - Intergenic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160099244 18:75904873-75904895 CAAGCAAAGGAGAAGGAAACAGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161056428 19:2192932-2192954 CAGTGGGAAGAGAAGCACACAGG - Intronic
1162633378 19:11946168-11946190 CAGTTAAAGAAGAAACAAAATGG - Intronic
1162705462 19:12551604-12551626 GAGTGACAGGAGAAGCAATGCGG + Intronic
1163226999 19:15969991-15970013 CAGTGAAAGAAAAGACAAACAGG + Intergenic
1163346376 19:16745105-16745127 AAGGCAAAGGAGAAGCAAAGAGG + Intronic
1164993341 19:32700503-32700525 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
1165884556 19:39068662-39068684 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1165922301 19:39307038-39307060 GAGAGAAAGGAGAGGCAAATAGG + Exonic
1166116603 19:40659563-40659585 CAGTCAAGGCAGAAGCACACTGG - Intergenic
1167488962 19:49780995-49781017 CAGGGACAGGAGAAGCAGAGAGG + Intronic
1167893712 19:52563750-52563772 CAGTGAAGAGAACAGCAAACAGG + Intronic
1168518088 19:57025318-57025340 CGGTGAATGGATAAACAAACTGG + Intergenic
1168548312 19:57272230-57272252 GAATGAAAGGAGAAGCTGACTGG + Intergenic
925879224 2:8337484-8337506 CAGAGAAAGAACAAGCAAAAAGG - Intergenic
927408339 2:22797400-22797422 GAGTGAAAGAAGAGGCAAGCAGG + Intergenic
928151822 2:28837821-28837843 CAGGGAGAGGAGAAGCTGACTGG + Intronic
930250442 2:49028722-49028744 CAGTGTATGGAGAAGCACAATGG - Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930853343 2:55985589-55985611 CGGTGAAAGGAAATGAAAACAGG - Intergenic
931524100 2:63133645-63133667 AAGGCAAAGGAGAAGCAGACAGG - Intronic
932112986 2:69018277-69018299 CAGTGGAAGAAAAAGAAAACTGG - Intronic
932583074 2:73005133-73005155 AAGTGGAAGGAGAGGGAAACAGG + Intronic
933165821 2:79073500-79073522 CAGAGAAAGGAGGAGCTAAGTGG - Intergenic
933169927 2:79113931-79113953 CAGGGAAAGGAGGGGCAAAGTGG + Intergenic
933564475 2:83932969-83932991 CACTCATAGGAGAAGAAAACAGG + Intergenic
934786664 2:97014364-97014386 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
934907920 2:98221937-98221959 AAGTGAAAAAAGAAGCAAGCTGG + Intronic
935153782 2:100464098-100464120 CAGTGAGAGGAGAAGCTACAAGG - Intergenic
935300783 2:101692239-101692261 CAGGAAAAGAAGAAGCAGACAGG - Intergenic
935468706 2:103430896-103430918 AATTGAGAGGAGAAGCAAATAGG - Intergenic
936090138 2:109496459-109496481 TAGTGAAAGGTGAAGCCAGCTGG - Intronic
937055976 2:118937162-118937184 GAAAGAAAAGAGAAGCAAACTGG - Intergenic
937509445 2:122577570-122577592 CAGTGAAAGGGCAAGCAGAGAGG + Intergenic
937759930 2:125588944-125588966 CAGTAAAGGGAGAGGCTAACTGG + Intergenic
938137205 2:128769421-128769443 CAATGAAAGAACAAACAAACAGG - Intergenic
938146510 2:128839046-128839068 CAGTGAGAGGACAAGCAAGGAGG - Intergenic
938200280 2:129367029-129367051 GAGGGGAAGGAGAGGCAAACGGG + Intergenic
938512641 2:131966708-131966730 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
938525235 2:132123307-132123329 AAGGCAAAGGAGAAGCAAACTGG + Intergenic
938594424 2:132772924-132772946 CAGTGAAAGGAGAGGAGAAATGG + Intronic
939198749 2:139007116-139007138 CAGTAAAAGCAAAAGCAGACTGG + Intergenic
939948841 2:148444279-148444301 CAGTGGAAGCAGAAGCCAAAAGG - Intronic
940738487 2:157480315-157480337 AAGTGAAAGGAAAAGCAAAGGGG + Intronic
940931580 2:159438302-159438324 CAGTGAATTGAGATCCAAACGGG - Exonic
941616097 2:167721600-167721622 TAGAGAAAGGAGGAGAAAACTGG + Intergenic
942267204 2:174240488-174240510 AAGTGAAAAGTCAAGCAAACTGG + Intronic
942371970 2:175294952-175294974 CAGTAGAAGCAGAAGCACACAGG - Intergenic
942706636 2:178780792-178780814 CAATGAAAACAGTAGCAAACTGG - Intronic
942712113 2:178848268-178848290 CAGTGAATGCAGAAGCACAATGG + Intronic
942728071 2:179032317-179032339 TAGTGAAAGTGGAAGCAACCAGG - Intronic
943633061 2:190276105-190276127 CAGTCAAAGCACAAGCAGACTGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944291452 2:198011261-198011283 CAGTGAAAGCAGTAGTAAAAGGG - Intronic
944857275 2:203780030-203780052 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
946179432 2:217940892-217940914 CAGTGAGAGGAGAACCAGAGAGG - Intronic
946192075 2:218012828-218012850 TGGTGAAAGAAGAAGCAAAGGGG - Intergenic
946274828 2:218623278-218623300 CATTTAAAGGAATAGCAAACAGG - Intronic
947032244 2:225809869-225809891 CAGTCAAAGCAAAAGCAGACCGG - Intergenic
947101387 2:226625111-226625133 CAGTCAAAGGAGAAGACAAAGGG + Intergenic
947169565 2:227297941-227297963 CAGGGAAAGAAGAAGCAACAAGG - Intronic
947285196 2:228506449-228506471 CAGGGAAAAGATAAGCTAACAGG - Intergenic
947448135 2:230180201-230180223 CAGGGAAAGGAAAAGCAAGGTGG + Intronic
948481143 2:238251373-238251395 CACTGAAATCAGAAGCAAACAGG + Intronic
948751811 2:240137447-240137469 GAGGGAAAGGAGAAGGAAAGGGG + Intergenic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170549068 20:17460178-17460200 CAGGAAAAGGAGAAGCACAAAGG + Intronic
1172754575 20:37274097-37274119 GAGGGAAAGGAGAAGGAAAGAGG + Intergenic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1173936917 20:46874562-46874584 CAGTCCAAGGAGAAGCCAAAGGG + Intergenic
1174095313 20:48084484-48084506 CTGTGAAAGGAAAATCAATCTGG + Intergenic
1174516209 20:51094304-51094326 CAGGGAAAGGAAAAGAAAACAGG + Intergenic
1175270806 20:57732693-57732715 AAGTGAATGGATAAACAAACCGG - Intergenic
1175658245 20:60790601-60790623 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1175891457 20:62317856-62317878 CAGGGAAGGGAGAAGAAAAGAGG + Intronic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176771288 21:13076547-13076569 AAGGCAAAGGAGAAGCAAACTGG - Intergenic
1176810203 21:13528865-13528887 CGGCAAAAGGAGAAGCAAAAGGG - Intergenic
1177221531 21:18199828-18199850 CAGTGAATGGACAAACAAACTGG - Intronic
1177240876 21:18455142-18455164 TGGTGGAAGGGGAAGCAAACAGG - Intronic
1178228793 21:30756228-30756250 TAGTGAAAGGAGAAGAAAAATGG - Intergenic
1178382714 21:32124260-32124282 CAGTGGAAGGTGAAGCACAGGGG - Intergenic
1178588937 21:33893073-33893095 CAGTGGCAGGGGATGCAAACGGG - Exonic
1178781627 21:35608959-35608981 ATTTGAAAGGAGAAGCAAACAGG + Intronic
1178835441 21:36093555-36093577 CACAGAAAGAAGAAGCAAAGTGG - Intergenic
1178936342 21:36865362-36865384 CCGAGAAAGGAGATGCAAGCAGG + Intronic
1178990056 21:37345674-37345696 CAGTGTCATGAGAAGCAAAAAGG + Intergenic
1179016202 21:37596086-37596108 CTGAGACAGGAGGAGCAAACAGG + Intergenic
1179505469 21:41836946-41836968 GAGTGACAGGAGCAGAAAACAGG - Intronic
1180436187 22:15306795-15306817 AAGGCAAAGGAGAAGCAAACTGG - Intergenic
1180518432 22:16170992-16171014 AAGGCAAAGGAGAAGCAAACTGG - Intergenic
1180647057 22:17347924-17347946 CAGAGAAAGTTGAAGCAAGCAGG - Intergenic
1182142431 22:27972693-27972715 CAGAGAGAGGAGAAGCGAAGAGG - Intergenic
1182277522 22:29200125-29200147 CAGTGGGAGGACAAGCAAGCTGG + Intergenic
1182936306 22:34225332-34225354 CAGTGAGAGGAGAAGAAAATAGG + Intergenic
1183162656 22:36125316-36125338 CAGTGAAAGTGTAAGCATACAGG + Intergenic
1183798174 22:40138147-40138169 GACTGACAGGAGAAGCATACAGG + Intronic
1185038638 22:48492646-48492668 AAGTGCCAGGAGACGCAAACAGG + Intronic
949463521 3:4319769-4319791 AAGTGAATGGATAAACAAACTGG + Intronic
950738699 3:15032440-15032462 CATTGAGAGGAAAAGCAGACGGG - Exonic
951297447 3:20956212-20956234 CAGTCAAAGCAGAAGCAGACAGG + Intergenic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
952693905 3:36243229-36243251 CAGTGAAAAGTGAAACAAAATGG - Intergenic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
954430338 3:50467463-50467485 CAGTAGATGGAGAAGCAAAGCGG - Intronic
956191089 3:66609287-66609309 CACTAAAAGGCGAAGCAACCAGG - Intergenic
957271024 3:78030124-78030146 CAGTGAGAGGTGAAGCAGGCTGG + Intergenic
957510395 3:81180685-81180707 TAGTGAAAGGTGAAGCCGACTGG + Intergenic
957650712 3:82999163-82999185 AAATGAAAGGAGAAATAAACTGG + Intergenic
957898141 3:86450248-86450270 CAGTGAAAAGATAAGGAAATGGG + Intergenic
958027717 3:88068363-88068385 AAGTGAAGGGAGAAGAAAAGTGG + Intronic
958724671 3:97889963-97889985 CAGTGATAAAAGATGCAAACAGG + Intronic
959306837 3:104678034-104678056 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
959903870 3:111689311-111689333 AAGTGACAGGAGAAGGAAATGGG + Intronic
960352078 3:116606274-116606296 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
961195776 3:125000169-125000191 CTCTGAAAGGAGAAGTAAATAGG + Intronic
961840651 3:129708447-129708469 CAGTTAAAGAAAAAGCAAACAGG - Intronic
962106640 3:132396614-132396636 CAGTGAAAGGTGAAGCCGGCTGG + Intergenic
962683095 3:137820677-137820699 CAGTCAAAGGAGAAGTTAAAGGG + Intergenic
962812634 3:138972497-138972519 CAGAGACAGGAGAAGCCAGCTGG + Intergenic
962961581 3:140315957-140315979 TAGTGGAAGGAGAAGCAGTCAGG + Intronic
963692761 3:148525435-148525457 CAGTGAAAGGTGAAGCTGGCTGG + Intergenic
964420626 3:156498964-156498986 CAGTCAAAGAAAAAGCAGACTGG + Intronic
965414901 3:168381015-168381037 CAGTGAAAGAAGTAGTAAAAGGG - Intergenic
965961898 3:174439542-174439564 CGGTGAAAGTAGAAACAAAGGGG + Intronic
967387234 3:188923770-188923792 AAGTGGAAGGAAAAGCAAGCAGG + Intergenic
967416251 3:189221930-189221952 CAGTGTAACGAGAAGACAACTGG - Intronic
967476729 3:189929993-189930015 TTGTGAAAGGAGAAGTAAAGGGG - Intergenic
968733068 4:2280778-2280800 CTGTGAAAGGAGAAGCCCATGGG + Intronic
969047706 4:4349127-4349149 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
970368755 4:15387137-15387159 CAGGAAAAGGAGAATCAAAGGGG + Intronic
971136681 4:23876641-23876663 CAGTTCAAGGAGGAGCAATCAGG - Intronic
971533740 4:27721800-27721822 CAGTGAGAGGTGAAGCTAGCTGG - Intergenic
971773861 4:30934207-30934229 CAGCGAAAGAAAAAGCATACTGG - Intronic
971869721 4:32219057-32219079 GAGTGAAAGCAGAAGCAGTCAGG + Intergenic
972518801 4:39834233-39834255 CAGTGAAAGGAAAAGCAGACTGG + Intronic
973074508 4:45905430-45905452 CAGTAAAATCAGAAGCAAAAAGG + Intergenic
973181849 4:47278558-47278580 CAATGACAGCAGAAGTAAACTGG + Intronic
973533480 4:51856754-51856776 CAGTGTAAGGAAAAACTAACAGG - Intronic
973864675 4:55100108-55100130 GAGTGCAAGGAGAATCAAACCGG + Intronic
973884859 4:55310281-55310303 CAGTGAAAAGAGAAAAAAGCAGG + Intergenic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
975092899 4:70424201-70424223 CACTGAACAGAAAAGCAAACAGG + Intergenic
976294812 4:83459748-83459770 CAGTAAATGGAGAAACAAACTGG - Exonic
978373239 4:108050318-108050340 CAGTGAAGGGACAAGAAGACTGG + Intronic
978373341 4:108050939-108050961 CAGTGAAGGGACAAGAAGACTGG - Intronic
978739232 4:112118993-112119015 AAGGGAAGGGAGAAGGAAACAGG + Intergenic
979235237 4:118392573-118392595 CAGTGATAGGTGAAGCCAGCTGG + Intergenic
979443697 4:120784467-120784489 CAGCGCAAGGAGTAGCAAACAGG - Intronic
980760197 4:137222826-137222848 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
981726188 4:147849927-147849949 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
982275789 4:153636004-153636026 ATGTGAAAGGAGAAGCCATCGGG - Intronic
982535023 4:156599939-156599961 CTGTGATAGGAGAAGTATACAGG + Intergenic
982724380 4:158890202-158890224 CATTGAAAGGAACAGCAATCAGG - Intronic
983739764 4:171114892-171114914 CAGGGAAGGGAGAAGCAGAGTGG - Intergenic
983926330 4:173406850-173406872 AAGTGAAAGTATAAACAAACTGG - Intergenic
983957797 4:173717631-173717653 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
984468704 4:180136188-180136210 CAGTGATAAGAGAACCAAAGAGG + Intergenic
984598598 4:181700513-181700535 CAATGAAATGAGATGCAAAATGG - Intergenic
985150300 4:186940504-186940526 CAGTGAAAGTACAAACAAATAGG + Intergenic
985377821 4:189360567-189360589 CAGTGAGATAAGAAGGAAACAGG + Intergenic
985924457 5:3004915-3004937 TAGTCCAGGGAGAAGCAAACTGG + Intergenic
986349230 5:6861942-6861964 TAGGGAAAGGAAAAGCAAATAGG + Intergenic
986719051 5:10547099-10547121 CAGTGAAAAGGGGAGAAAACAGG + Intergenic
986943620 5:12987617-12987639 CAGGTAAAGGAAAATCAAACTGG + Intergenic
986981790 5:13456634-13456656 CAGTGAAACATGAAGCAAAGTGG - Intergenic
987705220 5:21454886-21454908 CAGTGAAGGGAGATGCAGTCAGG + Intergenic
987771319 5:22309354-22309376 AAGTGAAAAGAGAACAAAACAGG + Intronic
988300706 5:29422311-29422333 CAGTGAAGGGAGATGCAGTCAGG - Intergenic
988729460 5:33956408-33956430 CAGTCAAAGCAAAAGCAGACAGG + Intronic
988918792 5:35921874-35921896 CAGTTAAAAGAGGAGGAAACAGG - Intronic
989310417 5:40010666-40010688 GAGTGAAAGAAGATGGAAACAGG + Intergenic
989757681 5:44975312-44975334 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
989786737 5:45341586-45341608 CAGTCAAAGCAAAAGCAGACTGG + Intronic
990176821 5:53116979-53117001 CAGTAAAATGAGAAACAAACAGG + Intergenic
990384497 5:55246393-55246415 CAGAGGAAGGAGAAGCCAACAGG + Intergenic
990903535 5:60779139-60779161 CAGTGAAAGCAGCAGGAAAGGGG - Intronic
991196423 5:63939336-63939358 CAGTGAATGGGGTGGCAAACTGG + Intergenic
992170880 5:74100877-74100899 CAGTGAAAGGAAAAGCAGACTGG - Intergenic
992795776 5:80254222-80254244 AAGTTAAAAGAAAAGCAAACAGG - Intronic
994153126 5:96473039-96473061 AAGAGAAAGGAGAGGGAAACTGG - Intergenic
994703344 5:103166125-103166147 CAGTCAAAGCAGAAGCAGACTGG + Intronic
994777165 5:104049564-104049586 TAGGGAAAGGGGAAGTAAACAGG - Intergenic
995350112 5:111165142-111165164 CAATGAAAAGATCAGCAAACAGG - Intergenic
995408187 5:111826078-111826100 CAGTGAGAGGTGAAGCCACCTGG + Intronic
995568368 5:113455063-113455085 CGGTGGGAGGATAAGCAAACAGG - Intronic
995993901 5:118276612-118276634 CAAAGATAGGAGAAGCTAACGGG - Intergenic
996680001 5:126221220-126221242 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
997263817 5:132483448-132483470 CAGTGAAATGTGAAGGAAAGTGG - Exonic
997391388 5:133520092-133520114 CTGAGAAAGGAGAAGAAAAGAGG - Intronic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
998728021 5:145041333-145041355 CAGTGAGAGGAGAGACCAACGGG + Intergenic
998789914 5:145755168-145755190 CAGTCAAAGCACAAGCAGACTGG + Intronic
999649418 5:153750649-153750671 CAGTGTGAGGAGCAGCAACCTGG - Intronic
999840476 5:155419922-155419944 GAGTGAAATGATAAGGAAACAGG - Intergenic
999925387 5:156370220-156370242 CAATGACAGGAAAAGCAAAGAGG + Intronic
1000291539 5:159875788-159875810 CAGGGAAAGGAGAAGAAAAAGGG + Intergenic
1001223491 5:169924135-169924157 CTGTGCAGGGAGAAGCAGACTGG - Intronic
1001582105 5:172805964-172805986 AAGAGAAAGGAGAAGCAAGGCGG - Intergenic
1001750605 5:174127955-174127977 CACTGAAAGGAAAATCCAACTGG + Intronic
1002078329 5:176723080-176723102 CAGTGAAAAGAGCAGCAAAGAGG + Intergenic
1002615563 5:180452993-180453015 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1003193426 6:3893874-3893896 CAGTGAGAGGTGAAGCCAACTGG - Intergenic
1004375151 6:15084671-15084693 AACTGGCAGGAGAAGCAAACTGG - Intergenic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1005091241 6:22059109-22059131 CAGAGAAAAGGGAAGAAAACAGG - Intergenic
1005900461 6:30213111-30213133 GAATGTAAGGACAAGCAAACAGG + Intronic
1007115613 6:39341119-39341141 CAGTGACAGGAGCAGAGAACTGG - Intronic
1008140455 6:47825822-47825844 CAGTCAAAGGAGAACCCAACTGG - Intronic
1008540394 6:52541677-52541699 CAGTGAAAGGAGAACCTATCTGG - Intronic
1008946490 6:57102720-57102742 CATTCCAAGGGGAAGCAAACTGG - Intronic
1009023083 6:57966020-57966042 CAGTGAAGGGAGATGCAGTCAGG - Intergenic
1010045716 6:71440896-71440918 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1011016496 6:82761807-82761829 CAAAGAAATGAGAAACAAACTGG + Intergenic
1011058445 6:83233185-83233207 CAGTGAAAAGAGAATGAAAAGGG - Intronic
1011486586 6:87848581-87848603 CAGAGAAAGAAGATGCAATCGGG - Intergenic
1011738898 6:90339752-90339774 CAGTTTAAGGAGAAGCATATAGG + Intergenic
1012212159 6:96532627-96532649 TAGTGAAAGAGGAAGCAAAGGGG - Intronic
1012523646 6:100151016-100151038 CAGAGAAAGGAGCAGCTAGCAGG + Intergenic
1012624687 6:101392240-101392262 CAGTGAAGGAGGAAGCAAAAGGG + Intergenic
1012880277 6:104779179-104779201 AAGTCAAAGGAGAAGCAAGGTGG + Intronic
1013000933 6:106021562-106021584 CAGTTAATTGAGAAGCAAAATGG + Intergenic
1013487796 6:110614662-110614684 GAGTGCTAGGAGAAGGAAACAGG + Exonic
1013766529 6:113580342-113580364 CATTGCAAAGAAAAGCAAACAGG - Intergenic
1014143033 6:117965739-117965761 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1014817249 6:125949753-125949775 CAGAAAAAGGAGAAGCCAACAGG - Intergenic
1015389099 6:132661116-132661138 CAGTGATAGAACAAGCAAAAGGG + Intergenic
1016741060 6:147528977-147528999 CAGGGAAAGCTGAAGCAATCTGG - Intronic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017421509 6:154277726-154277748 CAGGGAAAGGTGAAGTAAAGTGG - Intronic
1018443119 6:163831593-163831615 CAGTGAAGGGGGAATAAAACGGG + Intergenic
1018499126 6:164384038-164384060 CAGTGAAAGAATGAGCACACAGG - Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018734844 6:166679949-166679971 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1018882938 6:167903494-167903516 CAATGAAAGGTGGAGGAAACGGG - Intronic
1019356768 7:584218-584240 CAGCAAAGGGAGAAGCAGACAGG + Intronic
1020012288 7:4812774-4812796 CAGTGAACTAGGAAGCAAACAGG - Intronic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021006124 7:15397066-15397088 CAGTGACAGGTGAAGCCAACTGG - Intronic
1022278793 7:28883809-28883831 CAGTGGAAAGAGATTCAAACTGG + Intergenic
1022450326 7:30507839-30507861 CAGTGACAGGTGAAGCCAGCTGG - Intronic
1022884089 7:34623579-34623601 AAGTGAAATGAGAAGCTACCCGG + Intergenic
1022912786 7:34916469-34916491 CAGTGAAAGTAGAAGGACAGTGG + Intergenic
1023070808 7:36431162-36431184 CACTGTAAGGAAAAGCAAAAAGG + Intronic
1023473452 7:40550959-40550981 AAGAGAAAAGAGAAGAAAACAGG - Intronic
1023851726 7:44153823-44153845 CAGGGAAAGGAGGGGCTAACTGG + Intronic
1024142858 7:46480091-46480113 CAGTGATATGTGAAGCAAAGGGG - Intergenic
1024265541 7:47603507-47603529 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1025665454 7:63580766-63580788 CCGAGAAAGGAGAAGCAGCCGGG + Intergenic
1026172758 7:67968789-67968811 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1028361486 7:89972285-89972307 CAGTGGATGGAGAAGTAAATGGG - Intergenic
1028707389 7:93865954-93865976 CAGGGAAAGAAGAAACAAAAGGG - Intronic
1028728707 7:94120212-94120234 GAGTGATAGGAGGAGAAAACAGG - Intergenic
1029957013 7:104650789-104650811 CAATGACAGGAGAAGGAAACAGG + Intronic
1029974987 7:104825348-104825370 CTGTGAAAAGAGAAGCAACATGG + Intronic
1030095423 7:105894487-105894509 AAGAGAAAGGAGAAGCCAAAGGG + Intronic
1030436659 7:109530223-109530245 CACTCAAAAGAGAAGCAAAGCGG - Intergenic
1031204451 7:118737912-118737934 GAGTGAAATGAGAGGCAAAGAGG - Intergenic
1031895758 7:127346823-127346845 CTGTGAAAGGAGAGGGGAACTGG + Intronic
1031957645 7:127958491-127958513 CACTGAAAGGTGGAGCAAAGTGG - Intronic
1032722680 7:134563568-134563590 CAGTGAGAGGTGAAGCCACCTGG + Intronic
1033925547 7:146455406-146455428 AATTGAAAGGAAAAGCATACGGG - Intronic
1034142204 7:148831316-148831338 AAGTGAAATGAGATGAAAACAGG - Intronic
1034336624 7:150327931-150327953 CAAAGAAGGGAGAAGCAACCGGG - Intronic
1034859170 7:154581483-154581505 CAGGGAAAGGAGGAGAACACGGG + Intronic
1035118315 7:156543801-156543823 CATTGAAAGGAGAGGCAGAGTGG + Intergenic
1035795230 8:2350034-2350056 TGGTGAAAGGGGAAGCAAACAGG - Intergenic
1038028840 8:23618710-23618732 CAGTTTCAGGAGATGCAAACAGG + Intergenic
1038315370 8:26480194-26480216 CAGTTAAAGGTGAAGAAAACAGG + Intronic
1038577149 8:28715004-28715026 AAGATAAATGAGAAGCAAACTGG + Intronic
1039478479 8:37854624-37854646 CAGGGAAAACAGAATCAAACCGG + Intergenic
1039965704 8:42281933-42281955 CAGTCACAGGAGAAACAAAAGGG - Intronic
1040638808 8:49306613-49306635 CAGTGAGAGGTGAAGCCGACTGG + Intergenic
1041135185 8:54750494-54750516 CACTGAGAGGAGAAGCCAGCTGG + Intergenic
1041346202 8:56901188-56901210 CAGTGAAAGCATAACCAAACAGG - Intergenic
1042071828 8:64943285-64943307 ATTTGAAAGGAAAAGCAAACAGG - Intergenic
1042599573 8:70485237-70485259 CAGAGAAAGGAAAGGCACACAGG - Intergenic
1042865529 8:73353630-73353652 GGATGAATGGAGAAGCAAACAGG + Intergenic
1044303479 8:90611379-90611401 CAGTGGAAGGAGGGACAAACAGG - Intergenic
1044394569 8:91695584-91695606 AAGTGGAAGGGGTAGCAAACTGG - Intergenic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045393907 8:101741625-101741647 CAGTGAAAGGAAAAAAAAAAAGG + Intronic
1045895487 8:107211027-107211049 CAGTCAAAGCAAAAGCAGACTGG + Intergenic
1045958895 8:107943582-107943604 CTGATAAAGTAGAAGCAAACTGG + Intronic
1046098952 8:109592653-109592675 CAGAGAAATGATAAGCAAAGAGG + Intronic
1047120052 8:121892572-121892594 AATTGAAAGGAAATGCAAACTGG - Intergenic
1047367222 8:124222648-124222670 CAGTGGAAGGAGAGGGTAACAGG - Intergenic
1047775907 8:128070236-128070258 CAGCAACAGGAGAAGCAAACAGG - Intergenic
1048041150 8:130729851-130729873 CAGGGAAATGAGAAGCATAGAGG + Intergenic
1048276122 8:133067305-133067327 TAGAGAAAGGAGAAGCAGATGGG - Intronic
1048612071 8:136033821-136033843 CAGTGAGATGAGAAGCAATCAGG + Intergenic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1050640863 9:7666176-7666198 CAGTGAAAGGAGCAGGGAATTGG + Intergenic
1050923978 9:11240585-11240607 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1051322611 9:15924659-15924681 CAATGAAAGGAGAGGAAAACAGG - Intronic
1051555321 9:18376077-18376099 AAGTGAAAGGTGAAGCCAGCTGG - Intergenic
1051973319 9:22918239-22918261 CAGTGAAATGACATGCAATCAGG + Intergenic
1052032064 9:23640032-23640054 CAGAGAAGGGAGAAGCATATAGG - Intergenic
1052040723 9:23735875-23735897 CAGAGCAAGGAGAGGAAAACAGG + Intronic
1052486952 9:29113809-29113831 CAGTCAAAGCAAAAGTAAACTGG + Intergenic
1053069348 9:35091929-35091951 CAGGGAGAGGAGTGGCAAACAGG + Exonic
1053703950 9:40730760-40730782 AAGGCAAAGGAGAAGCAAACTGG + Intergenic
1054414033 9:64854369-64854391 AAGGCAAAGGAGAAGCAAACTGG + Intergenic
1055101165 9:72467146-72467168 CAGTGAAAGCAGCAGTGAACAGG - Intergenic
1055896960 9:81188233-81188255 CAGTGAAATGAAAAGAAAGCGGG - Intergenic
1055951111 9:81730521-81730543 CAGTGAGAGGCGAAGCCAGCTGG + Intergenic
1057341327 9:94204502-94204524 CAGTGAGAGGCGAAGCCAGCTGG + Intergenic
1057547616 9:96030007-96030029 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1057798517 9:98175169-98175191 GAGTGAAAGGGGAAGCAGACAGG - Intronic
1058346096 9:103964813-103964835 CAGTGTAAGGGGCATCAAACTGG - Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1060397285 9:123325139-123325161 CATTGAAGGCAGAAGGAAACAGG - Intergenic
1060680578 9:125559808-125559830 CACTGAAAGGAAAACCAAAAAGG + Exonic
1061475339 9:130861859-130861881 CAATGAAAAGAGAAGAAAACAGG + Intronic
1061507505 9:131039702-131039724 CAGTGCAAGGAGGAGCTAATAGG + Intronic
1186463477 X:9766084-9766106 AAGTGGAAGGAGAAGCAGAAAGG + Intronic
1186628697 X:11324295-11324317 CAGTCAAAGTAAAAGCAGACTGG + Intronic
1187060260 X:15780239-15780261 GAGTGAAAAGAGCAGCAAAATGG - Intronic
1188236659 X:27739915-27739937 CAGAGAAAGGAGAATAAATCTGG + Intronic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188303623 X:28535304-28535326 AAGTGGAAGGAGGAGAAAACAGG - Intergenic
1188608205 X:32060516-32060538 CAATGAAGGAAGTAGCAAACCGG - Intronic
1188629315 X:32332592-32332614 CTGTGAAAGCAGCAGCAAAGGGG + Intronic
1189684207 X:43546855-43546877 CAGTCAAAGCAAAAGCAAACTGG - Intergenic
1190804936 X:53826123-53826145 CAGTAAATGGAGAAACAAACTGG - Intergenic
1192309981 X:70003232-70003254 GAGTGTAGGGAGAAGAAAACCGG - Intronic
1193022841 X:76810287-76810309 CAGTGAAAGCAGAACAAAAAGGG + Intergenic
1193043261 X:77025648-77025670 TGGTCAAAGGATAAGCAAACAGG + Intergenic
1194077720 X:89417272-89417294 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1194647093 X:96471228-96471250 CAGTGACAGGAAAAGCAAAGAGG - Intergenic
1194701290 X:97118287-97118309 TAGGGAAAGGAGAAGGAAAATGG - Intronic
1195431938 X:104798715-104798737 CAGTGAAAGAAGATGGAAATGGG - Intronic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195890252 X:109685660-109685682 CAGTGAAATGAGAAAGAAACTGG + Intronic
1196027300 X:111054586-111054608 CAGTGTATGGAGAAACAAAGAGG - Intronic
1196663646 X:118294407-118294429 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1196818685 X:119685889-119685911 CAGTCAAAAGAGAGGGAAACAGG - Intronic
1196853043 X:119956903-119956925 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1197323664 X:125065158-125065180 CAGTCAAAGCAAAAGCAGACAGG + Intergenic
1198041850 X:132860365-132860387 AAGTGAAAGGAGAGGCCATCTGG - Intronic
1198075098 X:133186339-133186361 CAGGGAAAGGAGCAGGAAAGAGG + Intergenic
1199287381 X:146068547-146068569 CACTTAAAGGAAAAGCAATCAGG - Intergenic
1199554045 X:149087253-149087275 CAGTGAGAGGCGAAGCCAGCTGG - Intergenic
1199708543 X:150451670-150451692 GAGGGAAAGGAAAAGCAAAAGGG - Intronic
1199739484 X:150719908-150719930 GAGTGAAAGGAAAAGAAAATGGG - Intronic
1199864890 X:151835453-151835475 AAGTGAATGGATAAACAAACTGG + Intergenic
1199924668 X:152450281-152450303 CAGTCAGAGGAGCAACAAACTGG + Intronic
1199988579 X:152970422-152970444 CACTGAAAAGAAAAGCAAGCTGG - Exonic
1200430372 Y:3072817-3072839 CAGTGACAGGTGAAGCCAGCTGG + Intergenic
1200749343 Y:6930513-6930535 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1200983896 Y:9286565-9286587 CAGTTAAAAGAGAAACAAAATGG - Intergenic
1201711047 Y:16992486-16992508 AAGTGAGAGGAGAAGCCAGCTGG + Intergenic
1201931226 Y:19351658-19351680 TAGTGAGAGGAGAAGCCAGCTGG + Intergenic
1202152439 Y:21855728-21855750 CAGTTAAAAGAGAAACAAAATGG - Intergenic