ID: 1072389643

View in Genome Browser
Species Human (GRCh38)
Location 10:94969730-94969752
Sequence GAGGCTAAACTGAAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1327
Summary {0: 2, 1: 0, 2: 17, 3: 333, 4: 975}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072389643_1072389649 24 Left 1072389643 10:94969730-94969752 CCTCCCTGCTTCAGTTTAGCCTC 0: 2
1: 0
2: 17
3: 333
4: 975
Right 1072389649 10:94969777-94969799 CATTCCCAGTGAGATGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072389643 Original CRISPR GAGGCTAAACTGAAGCAGGG AGG (reversed) Intronic
900134583 1:1110193-1110215 GTGTCTAAACTGAAAAAGGGTGG + Intronic
900479881 1:2892936-2892958 GAGGGGAAACTGAGGCACGGGGG + Intergenic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
900818745 1:4870261-4870283 GAGGACATACTGGAGCAGGGTGG + Intergenic
901225410 1:7610481-7610503 GAGGAGAAACTGAGGCTGGGGGG - Intronic
902876207 1:19342370-19342392 GAGGCTCCTCTGAAGCATGGGGG + Intronic
903473629 1:23604796-23604818 GAGGTCATACTGAAGCAGGATGG + Intronic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
904447308 1:30585579-30585601 GAGGGAAAGCTGAAGCAGGGCGG - Intergenic
904712143 1:32438247-32438269 GAGGATATACTGAAGCATGTTGG - Intergenic
905049303 1:35035620-35035642 GAGGCCACACTGAAGGAAGGTGG + Intergenic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906714434 1:47956382-47956404 GAGCATGAGCTGAAGCAGGGCGG + Intronic
906740033 1:48173516-48173538 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
906753312 1:48285733-48285755 GAGGGAAAGCTGAAGCTGGGTGG - Intergenic
907015099 1:51005082-51005104 GAGGGTAAGCCAAAGCAGGGTGG + Intergenic
907126641 1:52056366-52056388 GGGTCTCACCTGAAGCAGGGAGG - Exonic
907362407 1:53929215-53929237 GATGTCACACTGAAGCAGGGAGG - Intronic
907827311 1:58031239-58031261 GAGGCTGAATGGAAGCATGGAGG + Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908813579 1:68009057-68009079 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
909261311 1:73492131-73492153 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
909448971 1:75777735-75777757 GAGGGTGAGCTGAAGCAAGGTGG + Intronic
909557398 1:76969190-76969212 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
909668105 1:78158847-78158869 GAGGGCAAGCTAAAGCAGGGCGG + Intergenic
910281696 1:85508491-85508513 GAGGGCAAGCTGAAGCAGGGCGG + Intronic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910383558 1:86657589-86657611 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
910606339 1:89088831-89088853 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910913708 1:92265677-92265699 GAGGATCACCTGAAGCTGGGGGG + Intronic
910915074 1:92279626-92279648 GAGGGCAAGCTGAGGCAGGGCGG + Intronic
910930295 1:92436730-92436752 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
911270572 1:95797057-95797079 GAGGGTGAGGTGAAGCAGGGTGG + Intergenic
911339308 1:96617828-96617850 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
911342039 1:96651403-96651425 GAGGGTGAGCTGAAGAAGGGCGG + Intergenic
911370177 1:96986990-96987012 GAGGCTAGAATAAAGCAGGCAGG + Intergenic
911399530 1:97357973-97357995 GAGGATGAGCTGAAGCAGTGGGG + Intronic
911541435 1:99162530-99162552 GAGGGTGAGCTGAAGCAGGCTGG - Intergenic
911596170 1:99800883-99800905 GAAGGCAAGCTGAAGCAGGGTGG - Intergenic
911982676 1:104586216-104586238 GAGGCAGAGCAGAAGCAGGGTGG + Intergenic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
912646128 1:111393906-111393928 GAGGGTCAGGTGAAGCAGGGCGG + Intergenic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913108742 1:115639768-115639790 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
913301874 1:117379637-117379659 GAGGCTAGGGGGAAGCAGGGAGG - Intronic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
915002782 1:152608770-152608792 GATGCAAAACTGCAGCAGAGTGG - Intergenic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915077398 1:153320399-153320421 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915307600 1:154989608-154989630 GAGGCTGTACTGAGCCAGGGAGG - Exonic
915651520 1:157315405-157315427 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
915654570 1:157348567-157348589 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
916038426 1:160941874-160941896 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
916251816 1:162746145-162746167 GAGTGTGAGCTGAAGCAGGGTGG + Intronic
916379619 1:164195447-164195469 GAGGTTGAGCTGAAGCGGGGTGG + Intergenic
916406194 1:164500325-164500347 GAGGGCAAGCTGAAGCAAGGTGG + Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
917009848 1:170458371-170458393 GAGGGTTAGATGAAGCAGGGTGG - Intergenic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
917163231 1:172080921-172080943 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
917257584 1:173132216-173132238 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
917264972 1:173211084-173211106 GGTCCTAAACTAAAGCAGGGAGG + Intergenic
917357680 1:174143717-174143739 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
917401460 1:174653569-174653591 GGGGGCAACCTGAAGCAGGGTGG - Intronic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
917573717 1:176297065-176297087 GAGGGCAAGCCGAAGCAGGGAGG - Intergenic
917893786 1:179466086-179466108 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918353760 1:183684884-183684906 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
918501578 1:185201546-185201568 GAGGGCAAGCTGAAGCAGAGTGG - Intronic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
918970159 1:191404429-191404451 GAGGTCAAACTGCAGTAGGGTGG + Intergenic
919063967 1:192668932-192668954 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
919423258 1:197398426-197398448 AAGGCAAAACTGAAGGAAGGCGG + Intronic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920631783 1:207659675-207659697 GAGGGCAAGCTGAAGCAGAGCGG + Intronic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
920993192 1:210959879-210959901 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
921004088 1:211075752-211075774 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
921034794 1:211366665-211366687 GAGCTTGCACTGAAGCAGGGAGG + Intronic
921455494 1:215365914-215365936 GAGAGTGAGCTGAAGCAGGGCGG - Intergenic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
921976253 1:221206728-221206750 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922205272 1:223441006-223441028 GAGGCTATACTGGAGTAGGGTGG - Intergenic
922406298 1:225316647-225316669 GAGGGAGAACTGAAGCAGGGTGG - Intronic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922737600 1:227996254-227996276 GAGTTTACACTGCAGCAGGGAGG + Intergenic
923067062 1:230527567-230527589 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
923421646 1:233822116-233822138 GAGGGCAAGTTGAAGCAGGGTGG + Intergenic
923690997 1:236192635-236192657 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924253486 1:242158610-242158632 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
924295930 1:242586785-242586807 GAGGGCAAGCCGAAGCAGGGAGG + Intergenic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
1062961984 10:1579071-1579093 CAGGGTAAACTGAGGCAGTGTGG - Intronic
1063448205 10:6133548-6133570 GAGGCCAAACTAAACCAGGCGGG - Intergenic
1063827140 10:9910797-9910819 GAGGCTAGAATAAAGCAGGCAGG - Intergenic
1064036967 10:11921963-11921985 AAGGCCATACTGGAGCAGGGTGG + Intronic
1064492925 10:15878513-15878535 GAGGGGGAGCTGAAGCAGGGCGG - Intergenic
1064829538 10:19446251-19446273 GAGTGTAAGCTGAAGCAGGGTGG - Intronic
1064883194 10:20080604-20080626 GAGGCTAGAATAAAGCAGGCAGG - Intronic
1065076082 10:22080592-22080614 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
1065076874 10:22089421-22089443 GAAGGTGAGCTGAAGCAGGGTGG + Intergenic
1065121067 10:22530754-22530776 GAGGGCAAACAGAAGCCGGGTGG - Intergenic
1065799081 10:29334796-29334818 GAGGGTGAACTGAAATAGGGCGG + Intergenic
1065907566 10:30271962-30271984 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1066140866 10:32502354-32502376 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1066162959 10:32754794-32754816 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
1066257728 10:33696580-33696602 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066751218 10:38659332-38659354 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1066965826 10:42263759-42263781 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1067209776 10:44250199-44250221 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1067231795 10:44417328-44417350 GAGGCCATACTGGAGCAGGGTGG - Intergenic
1067332353 10:45333919-45333941 GAGGGTGAACTGAGGCAGGGTGG - Intergenic
1068092851 10:52454359-52454381 GAGGCTATACTGAGGAAGGGAGG + Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068470046 10:57448782-57448804 GAGGGTGACCTGAAGCATGGTGG - Intergenic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1068759324 10:60690255-60690277 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1069227229 10:65959357-65959379 GAGTGTTAGCTGAAGCAGGGAGG - Intronic
1069264372 10:66438988-66439010 GAGGGTGACCCGAAGCAGGGTGG - Intronic
1069355944 10:67585031-67585053 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1070007134 10:72435562-72435584 GAGGACGAGCTGAAGCAGGGCGG + Intronic
1070081228 10:73190366-73190388 GAGGCTATACTGGACCATGGTGG - Intronic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1071441591 10:85702758-85702780 GAGGATAAACGGAGGCAGAGAGG + Intronic
1071698530 10:87903819-87903841 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1071922934 10:90371792-90371814 GAGGGTGAGCTGAAGCAGGCGGG - Intergenic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1072374527 10:94800991-94801013 GAGGGTGAGCTGAAGAAGGGTGG - Intronic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072477649 10:95778117-95778139 GAGGACGAGCTGAAGCAGGGCGG - Intronic
1072480600 10:95807481-95807503 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072548847 10:96461600-96461622 GAGGCTAAACAAAGGCATGGAGG - Intronic
1072775107 10:98183011-98183033 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1072900349 10:99401575-99401597 GAGAATAACCTGAAGCCGGGAGG + Intronic
1073255903 10:102151208-102151230 GAGGATCAACTGAGCCAGGGAGG - Intergenic
1073517735 10:104092546-104092568 GAGGCTTAACTCTACCAGGGTGG - Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074016848 10:109542869-109542891 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1074117852 10:110471009-110471031 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1074919002 10:117988287-117988309 GAGGCAAGACAGGAGCAGGGTGG - Intergenic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075805396 10:125184955-125184977 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1076389706 10:130090259-130090281 GAGGGACAACTGAAGCAGGGTGG + Intergenic
1076735536 10:132457403-132457425 AAGGGGAAACTGAGGCAGGGTGG + Intergenic
1077247208 11:1545478-1545500 GAGGCCACACTGGAGTAGGGTGG + Intergenic
1077286536 11:1768464-1768486 GAGATTAAAATGAAGCTGGGGGG + Intergenic
1077799584 11:5524748-5524770 GAGGGTAGACAGAAACAGGGAGG - Intronic
1077803784 11:5569427-5569449 GAGGGCAAACCAAAGCAGGGTGG + Intronic
1078331567 11:10426377-10426399 GAGGACAAGCTGAAGCAGGGTGG - Intronic
1078392987 11:10952555-10952577 GAGGGTCAGCCGAAGCAGGGTGG - Intergenic
1078429109 11:11274029-11274051 GAGGACAAGCTGAAGCAGGGTGG + Intronic
1078981133 11:16536474-16536496 GAGGGTGAGCTGAAGAAGGGCGG + Intronic
1079129969 11:17741568-17741590 GAGGATAAACTGGAGCAGCCAGG - Intronic
1079348885 11:19676172-19676194 GAGGCCAGACTGGAGCAGGGAGG - Intronic
1079577783 11:22025130-22025152 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080117646 11:28638809-28638831 GAGGGCCAGCTGAAGCAGGGTGG + Intergenic
1080235886 11:30067595-30067617 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1080334464 11:31180546-31180568 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1080346899 11:31335374-31335396 GAGGGGAAGCTGAAGCAGGGCGG - Intronic
1080424210 11:32141382-32141404 GAGGATCACCTGAGGCAGGGAGG - Intergenic
1080615300 11:33940471-33940493 GGGGCTGGGCTGAAGCAGGGTGG - Intergenic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080818231 11:35779410-35779432 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1080917350 11:36673564-36673586 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081221505 11:40469226-40469248 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081682456 11:45017783-45017805 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1081958972 11:47119427-47119449 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1082872225 11:57953829-57953851 GAGGTTGAGCAGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083003716 11:59321429-59321451 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1083385607 11:62306956-62306978 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
1083497023 11:63064401-63064423 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1083516310 11:63262107-63262129 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1083749239 11:64752398-64752420 GTGGCCAAAGTGAAGCAGGTGGG - Exonic
1084701827 11:70791304-70791326 GAGCCTAAACTCCAGCAGGATGG + Intronic
1085452197 11:76641145-76641167 GAGGCTACACTGAAGTAGGGTGG + Intergenic
1085464900 11:76716690-76716712 GAGGCCAGACTGAGGCTGGGAGG - Intergenic
1085800671 11:79586240-79586262 GAAGGCAAGCTGAAGCAGGGTGG + Intergenic
1086086116 11:82956681-82956703 GAGGGTGAGCTGAAGCAGCGTGG - Intronic
1086117279 11:83266277-83266299 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086298187 11:85395426-85395448 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086494325 11:87386668-87386690 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1086506334 11:87508221-87508243 GAGGGTGAGTTGAAGCAGGGTGG - Intergenic
1086532445 11:87801482-87801504 GAAAGGAAACTGAAGCAGGGTGG - Intergenic
1086608371 11:88724752-88724774 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086732980 11:90271526-90271548 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1086812073 11:91322271-91322293 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1087003503 11:93445058-93445080 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1087263601 11:96037921-96037943 TAGGCTAAAATTAGGCAGGGTGG + Intronic
1087311111 11:96545152-96545174 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1087332119 11:96793521-96793543 GAGGACAAGCCGAAGCAGGGTGG - Intergenic
1087695375 11:101370067-101370089 GAGGTCAGACCGAAGCAGGGTGG - Intergenic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1087925058 11:103910443-103910465 GAAGGTGAGCTGAAGCAGGGTGG + Intronic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1088835792 11:113577131-113577153 GAGTCTAAACTCAATCCGGGAGG + Intergenic
1089597943 11:119593771-119593793 GAGGCTAAACCTCAGCAGAGGGG + Intergenic
1089744785 11:120609140-120609162 CAGGCCCAACTGAAGCAGGAGGG - Intronic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1090216347 11:124968628-124968650 GAGGGTGAACCGAAGCAGGGTGG - Intronic
1090722943 11:129493625-129493647 GAGGGCAAGCTGAAGCAGGGAGG + Intergenic
1090727847 11:129543858-129543880 GAGCCTACACTGAGGGAGGGAGG + Intergenic
1090790547 11:130089890-130089912 GAGGTCATACTGGAGCAGGGTGG - Intronic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1092185831 12:6477817-6477839 GAGGCCAAGCTGAAGCTGGCTGG + Intergenic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1092581765 12:9849879-9849901 GAGGCTGAGCCGAAGCAGGGTGG - Intergenic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092661963 12:10748206-10748228 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1092711313 12:11340388-11340410 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1092959195 12:13579881-13579903 GAGGCTGAATTGAAGCTGGCAGG + Intronic
1093545137 12:20336924-20336946 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1093597728 12:20981702-20981724 GAGGGCCAGCTGAAGCAGGGCGG - Intergenic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094311784 12:29092519-29092541 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1094703870 12:32896607-32896629 GAGGCCAAGCTGAAGCTGGCGGG - Exonic
1094757774 12:33492412-33492434 GAGGGTGAGCTGAAGAAGGGTGG + Intergenic
1095140504 12:38657048-38657070 GAGGGTGAGCTGAAGCAGTGCGG + Intronic
1095400885 12:41813870-41813892 GAGGCCACAGTGAAGCAGGGAGG - Intergenic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096649800 12:53056661-53056683 GAGACCATACTGAAGGAGGGTGG - Intronic
1096950069 12:55459456-55459478 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1097749549 12:63337031-63337053 GAGGGCAAGCTGAAGTAGGGTGG + Intergenic
1097856485 12:64468994-64469016 GAGGCTAGACTGATGCAGTAGGG - Intronic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1098315298 12:69186198-69186220 GTGGGACAACTGAAGCAGGGAGG - Intergenic
1098635535 12:72780040-72780062 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1098993935 12:77096428-77096450 GAGGGCAAGCGGAAGCAGGGAGG - Intergenic
1099022610 12:77424846-77424868 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099121571 12:78696016-78696038 GAGGCTAAATTAAATTAGGGTGG - Intergenic
1099216608 12:79861482-79861504 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1099236185 12:80084562-80084584 GAGGGCGAACTGAAGCAGGGTGG - Intergenic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099440019 12:82687469-82687491 GAGGGAAAAGTGAAGCTGGGAGG + Exonic
1099486331 12:83233109-83233131 GAGGGTGAGCGGAAGCAGGGTGG - Intergenic
1099491947 12:83299592-83299614 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1099522432 12:83681382-83681404 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1099697548 12:86040975-86040997 GAGGGTGAGTTGAAGCAGGGTGG - Intronic
1099699036 12:86061204-86061226 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1099820319 12:87700731-87700753 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1099897473 12:88667300-88667322 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1099921988 12:88970086-88970108 GTGGCTAAAATAAAGCAGGTAGG + Intergenic
1100110967 12:91242411-91242433 GAGGGTATGCCGAAGCAGGGTGG + Intergenic
1100417104 12:94389641-94389663 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1100699734 12:97134510-97134532 GAGGTTATGCTGAAGTAGGGTGG + Intergenic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1100900758 12:99238069-99238091 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1100942620 12:99740744-99740766 GAGGGCAAGCTGAAGCTGGGTGG + Intronic
1100965698 12:100010900-100010922 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1101301754 12:103489922-103489944 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1101601335 12:106212697-106212719 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1101621280 12:106391098-106391120 AAGGCTGAACTGAAGCAGCCTGG + Intronic
1101782279 12:107846457-107846479 GAGGCAAGACTAAAGCAGGAGGG + Intergenic
1101823366 12:108201396-108201418 GAGGCTAAACTGGAGTAGGCTGG - Intronic
1102345658 12:112159484-112159506 GAGGGTGATCTGAAGCAGGGTGG - Intergenic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103255736 12:119539978-119540000 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1103324665 12:120112373-120112395 GAGGTTGAACTGAAGCAGAGAGG - Intronic
1103346413 12:120253593-120253615 GAAGCTAAACTGAAGCCCAGAGG - Intronic
1104115690 12:125746842-125746864 GAAGGCAAGCTGAAGCAGGGTGG - Intergenic
1104175417 12:126326621-126326643 AAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1104835864 12:131789950-131789972 GAGGTGACACTGAAGCAGCGCGG + Intronic
1104901318 12:132190890-132190912 GAGGCCACCCTGGAGCAGGGTGG + Intergenic
1105201328 13:18182309-18182331 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1105645865 13:22316743-22316765 GAGAGCAAACTGAAGCAGGGTGG - Intergenic
1105960964 13:25338828-25338850 GAGTAAAAACTGAATCAGGGAGG - Intronic
1106025724 13:25953698-25953720 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1106153103 13:27125627-27125649 GAGGGTGAGCGGAAGCAGGGTGG + Intronic
1106261218 13:28068653-28068675 GAGGATCATCTGAACCAGGGAGG - Intronic
1106336112 13:28784476-28784498 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106882876 13:34150864-34150886 GAGGCAAAAATGAAGGAGGGGGG - Intergenic
1106983946 13:35322393-35322415 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
1108217645 13:48200901-48200923 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108304519 13:49118200-49118222 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1108458639 13:50642810-50642832 GAGGTCACACTGGAGCAGGGTGG + Intronic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109669383 13:65585316-65585338 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1109806598 13:67452421-67452443 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1110071511 13:71184434-71184456 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1110389631 13:74959287-74959309 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1111634994 13:90892541-90892563 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1112363086 13:98734452-98734474 GAGGGCAAGCTGAAGCAGAGTGG + Intronic
1112412091 13:99173291-99173313 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1112584586 13:100707065-100707087 GAGGCTATACTGGATGAGGGCGG - Intergenic
1112620232 13:101047220-101047242 GAGGGGGAACAGAAGCAGGGTGG - Intergenic
1113300974 13:109018792-109018814 GAGGGTGAGCTGAAGCAGAGCGG - Intronic
1113383871 13:109829344-109829366 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1113391787 13:109904857-109904879 GAAGTTATAGTGAAGCAGGGTGG + Intergenic
1113518221 13:110919387-110919409 GAGGTCACACTGAAGTAGGGTGG + Intergenic
1114133643 14:19821224-19821246 GAGGGTAAGCCAAAGCAGGGTGG - Intronic
1114265285 14:21069957-21069979 GAGGCTAAACTGATCCCGCGGGG + Intronic
1114335943 14:21690109-21690131 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114433705 14:22685868-22685890 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114677563 14:24453874-24453896 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1114817578 14:25978996-25979018 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1114981252 14:28168139-28168161 GAAGGTGAGCTGAAGCAGGGCGG + Intergenic
1115123174 14:29961335-29961357 GAGCGTGAGCTGAAGCAGGGTGG - Intronic
1115135820 14:30107103-30107125 GAGCGTGAACTGAAGCAGGGTGG + Intronic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115591493 14:34869981-34870003 GAGGCTAGGCTGAGGCAGGTTGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116401813 14:44516134-44516156 GAGGGTCAGCTGAAGCAGGGCGG - Intergenic
1116433680 14:44873929-44873951 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116675297 14:47898862-47898884 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1116848167 14:49883741-49883763 GTGTCTAAACTGCAACAGGGAGG + Intergenic
1117005724 14:51419151-51419173 GAGGGTGATCTGAAGCAGGGCGG - Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117169996 14:53084796-53084818 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1117237893 14:53798052-53798074 GAAGGTGAACTGAAGCAGGGTGG + Intergenic
1117617170 14:57545357-57545379 AAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117887608 14:60381772-60381794 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1117900674 14:60529262-60529284 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1118251392 14:64164975-64164997 GAGGATCAACTGAACCTGGGAGG - Intronic
1118412157 14:65492266-65492288 TAGGCTAAACTGAAGTAAGAAGG - Intronic
1118450015 14:65892217-65892239 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1118467826 14:66046765-66046787 AAGGTTAAACTGAATGAGGGAGG + Intergenic
1118510877 14:66471800-66471822 CAGGATAACTTGAAGCAGGGAGG - Intergenic
1118830002 14:69421977-69421999 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1119018564 14:71085138-71085160 GAGGGCAAGCCGAAGCAGGGTGG - Intronic
1119930610 14:78542660-78542682 GAGGGCAAGCTGAAGTAGGGTGG - Intronic
1120065720 14:80038947-80038969 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1120177823 14:81313964-81313986 GAAGCAATACTGAAGCAGAGAGG + Intronic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120969168 14:90192975-90192997 GAGGCTCACCTGAGGCCGGGAGG + Intergenic
1121470676 14:94151835-94151857 GAGGGTGAGCTGAAGCAGGTTGG - Intronic
1122443403 14:101750223-101750245 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1122555319 14:102576037-102576059 GAGGATCACCTGAACCAGGGAGG - Intergenic
1124195173 15:27619293-27619315 GAGGGCAAACTGGAGTAGGGGGG - Intergenic
1124244551 15:28058203-28058225 AAGGCAAAACTGCAGCAGGAGGG + Intronic
1124495800 15:30186097-30186119 GTGGCTATACTGCAGCAGGAAGG - Intergenic
1124495986 15:30187425-30187447 GTGGCTATACTGCAGCAGGAAGG - Intergenic
1124720039 15:32104016-32104038 GAGGCAACACTGAAGCAGGAAGG - Intronic
1124747588 15:32351222-32351244 GTGGCTATACTGCAGCAGGAAGG + Intergenic
1124747773 15:32352549-32352571 GTGGCTATACTGCAGCAGGAAGG + Intergenic
1124872190 15:33554163-33554185 GATGCAAAAATAAAGCAGGGTGG - Intronic
1125219478 15:37317223-37317245 AAGGGTGAACTGAAGCAGGGTGG + Intergenic
1125354632 15:38803768-38803790 GAGGGTGAGCTGAAACAGGGTGG - Intergenic
1125984678 15:44038699-44038721 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1126074543 15:44896510-44896532 GAGGGCTAGCTGAAGCAGGGCGG - Intergenic
1126087092 15:45021058-45021080 GAGGGTGAGCCGAAGCAGGGAGG - Intergenic
1126720044 15:51568953-51568975 GAGGTTGAGCTGAAGCAGGGTGG + Intronic
1126742030 15:51786998-51787020 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1127029938 15:54850878-54850900 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1127179395 15:56399130-56399152 GAGGGTGAACTGAAGCAGAGTGG + Intronic
1127253920 15:57271561-57271583 GAGGGTGAGCTGAATCAGGGTGG - Intronic
1127720343 15:61692985-61693007 GAGGCTAAAATGAACAAGGCAGG + Intergenic
1127720561 15:61694883-61694905 GAGGCCATACTGGAGCAGGGTGG + Intergenic
1127764613 15:62172926-62172948 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1128240456 15:66097676-66097698 GAAGCAGGACTGAAGCAGGGTGG - Intronic
1128339884 15:66813971-66813993 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1128883590 15:71265299-71265321 GAGGCTGAGCTGAAGCAGGGTGG + Intronic
1129060322 15:72855910-72855932 GGGGGAACACTGAAGCAGGGAGG + Intergenic
1129495680 15:75977609-75977631 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1130638955 15:85652908-85652930 GAGGTTATACTGGAGTAGGGTGG - Intronic
1130717440 15:86348944-86348966 GAGGTTATACTGGATCAGGGTGG + Intronic
1132096325 15:98987830-98987852 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1132196223 15:99916513-99916535 GAGGCCATACTGGAGTAGGGTGG + Intergenic
1132261572 15:100429693-100429715 GAGGATCAACTGAAGGATGGGGG - Intronic
1134312942 16:13092793-13092815 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1135512026 16:23094017-23094039 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
1135544395 16:23356032-23356054 GAGCATAAACTGAACCAGAGTGG + Intronic
1135864978 16:26092761-26092783 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1135897295 16:26419385-26419407 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1136731506 16:32417773-32417795 GAGGGTGAGCTGAAGCAAGGTGG - Intergenic
1137046098 16:35663892-35663914 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1137325020 16:47425417-47425439 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138843739 16:60539567-60539589 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1140134465 16:72193323-72193345 GAGGCTAAAGTGAACCATGATGG + Intergenic
1140675613 16:77326470-77326492 GAGGCTAACCTGAGCCAGAGAGG - Intronic
1140735984 16:77898207-77898229 GAGATTATACTGAAGTAGGGTGG - Intronic
1141130334 16:81432150-81432172 GAGGTCATACTGGAGCAGGGTGG + Intergenic
1141626928 16:85266336-85266358 TTGGCTCAACAGAAGCAGGGAGG - Intergenic
1141761973 16:86034446-86034468 GAGGCCATACTGGAGTAGGGTGG + Intergenic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1142220389 16:88851530-88851552 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1142281173 16:89148451-89148473 CAGGCTACACTGATGCATGGAGG + Intronic
1202994886 16_KI270728v1_random:99497-99519 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1203021573 16_KI270728v1_random:411839-411861 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1142743920 17:1945649-1945671 TGGGGTAAAGTGAAGCAGGGCGG - Intronic
1144293984 17:13855635-13855657 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1144667114 17:17109492-17109514 GAGGCTAGACTGATCCACGGAGG + Intronic
1145012956 17:19380033-19380055 GAATCTAATCTGAAGCAGGCTGG + Intronic
1145284867 17:21497929-21497951 GAGGGAGAACTGAAGAAGGGTGG + Intergenic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1147163220 17:38579593-38579615 GAGGAGAGACTGAAGAAGGGAGG - Intronic
1147349636 17:39830771-39830793 GAGGCTGGGCTGAAGTAGGGAGG + Intronic
1147415171 17:40283685-40283707 GAGGCTAAAGAAAAGAAGGGTGG + Exonic
1147644984 17:42028045-42028067 GAGACCCAACTGAAGCAGGTGGG - Exonic
1147802243 17:43100819-43100841 GAGAATCAACTGAACCAGGGAGG - Intronic
1148944606 17:51249168-51249190 GAGGATCACCTGAGGCAGGGAGG + Intronic
1148951595 17:51318137-51318159 CAGGATAACTTGAAGCAGGGAGG - Intergenic
1149093914 17:52817520-52817542 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1149222804 17:54435691-54435713 AAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1151064277 17:71132289-71132311 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1151234167 17:72706640-72706662 GAAGAAAAACAGAAGCAGGGTGG - Intronic
1151530343 17:74700290-74700312 GAGGCTGGAGTGAAGCAGGCAGG - Intronic
1151761091 17:76103628-76103650 GAGGACAAGCTGAAGCAGGTGGG - Exonic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153313495 18:3700418-3700440 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1153941605 18:9983109-9983131 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1154101629 18:11479728-11479750 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1154288623 18:13084596-13084618 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1154288817 18:13086479-13086501 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1154401622 18:14043552-14043574 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1155091448 18:22515307-22515329 GAGTCCAAACTGATGGAGGGAGG - Intergenic
1155114141 18:22748455-22748477 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1155338780 18:24793217-24793239 GTGGCTAATATGAAGCATGGAGG + Intergenic
1155384847 18:25266595-25266617 GAGGGCAAGCTGATGCAGGGTGG + Intronic
1155659333 18:28228969-28228991 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1156127287 18:33921507-33921529 GAGGCAATACTGAATTAGGGTGG + Intronic
1157025274 18:43835640-43835662 GAGGGTGAGCTGAAGCGGGGTGG + Intergenic
1157067380 18:44367246-44367268 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1157071660 18:44416065-44416087 GAGGGCTAGCTGAAGCAGGGTGG + Intergenic
1157558922 18:48632556-48632578 GAGGCTGAACTGGCCCAGGGGGG - Intronic
1157780615 18:50435399-50435421 GAGGGTGAGGTGAAGCAGGGTGG + Intergenic
1157804581 18:50648773-50648795 GAGGCTACAGTAAAGCAGGGAGG - Intronic
1158329428 18:56345088-56345110 GAGGCTACACTGGGGCAGAGAGG + Intergenic
1158388126 18:57018151-57018173 GATGCTAATCTGAAGGAGGAAGG + Intronic
1158825877 18:61218480-61218502 GAGGCCATACGGAAGTAGGGTGG + Intergenic
1158853288 18:61517432-61517454 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1158889538 18:61859981-61860003 GAGGTTATATTGGAGCAGGGTGG + Intronic
1158963954 18:62607639-62607661 GAGGTTATACTGGAGTAGGGTGG - Intergenic
1159099306 18:63940528-63940550 GAGTGTAAGCTGAAGCAGGGTGG + Intergenic
1159321550 18:66857215-66857237 GAGGCAGAACTGAATCTGGGAGG + Intergenic
1159570830 18:70110409-70110431 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1159645870 18:70917031-70917053 GAGGGCAAGCTGAATCAGGGTGG - Intergenic
1159661305 18:71098416-71098438 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1160904770 19:1446907-1446929 GAGGGGAAACTGAGGCTGGGGGG + Intronic
1161115924 19:2496283-2496305 GAGGGTAAACTGAGGCACAGAGG + Intergenic
1161232750 19:3183037-3183059 GAGGTCATACTGGAGCAGGGTGG - Intergenic
1161519660 19:4716731-4716753 GTGGGGAAACTGAAGCTGGGAGG + Intronic
1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG + Intronic
1162202359 19:9029839-9029861 GAGGATCACCTGAACCAGGGAGG + Intergenic
1162323874 19:9986858-9986880 GAGGCTAGGCAGAAGCTGGGAGG + Intronic
1162375051 19:10299926-10299948 GGGGGTAAACTGAAGCACTGTGG - Intergenic
1162516418 19:11150691-11150713 GAGGATCACCTGAACCAGGGAGG + Intronic
1163003218 19:14381825-14381847 GAGGGGAAACTGAGGCACGGGGG + Intronic
1163063475 19:14776421-14776443 GAGGGGAAACTGAGGCACGGGGG - Intronic
1163596775 19:18225209-18225231 GGGGGTAAACTGAGCCAGGGAGG + Intronic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1164152429 19:22566448-22566470 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1165003800 19:32787909-32787931 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1165281600 19:34802877-34802899 AAGGAAAAACTGAAGAAGGGAGG + Intergenic
1165899646 19:39163123-39163145 GGAGGTAAACTGAGGCAGGGAGG + Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166163725 19:40971440-40971462 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1166240235 19:41486502-41486524 GAGGGCTAGCTGAAGCAGGGTGG + Intergenic
1166994457 19:46713706-46713728 GAGGCTGAGCTGGAGCTGGGGGG - Intronic
1167642136 19:50687775-50687797 GGGGAGAAACTGAGGCAGGGAGG - Intronic
1168210156 19:54884309-54884331 GAGGCAACACTGAAGCCAGGGGG - Intronic
1168372130 19:55844623-55844645 GAGGTCATACTAAAGCAGGGTGG - Intronic
1168457607 19:56526211-56526233 GAGGGTGAGCTGAAGCAGGGTGG + Exonic
925204785 2:1996661-1996683 CAGCCCACACTGAAGCAGGGTGG - Intronic
925204825 2:1996868-1996890 CAGTCCACACTGAAGCAGGGCGG - Intronic
925204851 2:1997002-1997024 CAGCCCACACTGAAGCAGGGCGG - Intronic
925204877 2:1997136-1997158 CAGCCCACACTGAAGCAGGGTGG - Intronic
925510014 2:4615085-4615107 GAGTCTAAACTTAGGCAGAGCGG - Intergenic
925749806 2:7077821-7077843 GAGGCTAGACTGCAGCATGCTGG + Intergenic
926074777 2:9933131-9933153 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
926944062 2:18168501-18168523 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
927021407 2:19020787-19020809 GAGGGTGAGCTAAAGCAGGGCGG - Intergenic
928462609 2:31489234-31489256 GAGGGCAAGCTGAAGCAGGGGGG + Intergenic
928997350 2:37307111-37307133 GATGCACAACTGGAGCAGGGGGG - Intronic
929005382 2:37388411-37388433 AAGTCTAGAATGAAGCAGGGTGG - Intergenic
929025782 2:37600164-37600186 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
930114989 2:47710704-47710726 GAGGCAAAGATGAAGCAGTGGGG + Intronic
930274778 2:49298614-49298636 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
930323253 2:49882036-49882058 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
930908959 2:56606797-56606819 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931046822 2:58363149-58363171 GAGGATGAGCTGGAGCAGGGAGG - Intergenic
931323248 2:61193332-61193354 GTGGCTAGACTGCAGGAGGGAGG + Intronic
931594462 2:63926657-63926679 GAGGGTGCGCTGAAGCAGGGCGG + Intronic
932051613 2:68403847-68403869 GAGGGTGAGCTGAAGCTGGGTGG - Intergenic
932327972 2:70876046-70876068 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
932511894 2:72300824-72300846 GAGGGTAATTTGAAGCAGGGTGG - Intronic
932539925 2:72641235-72641257 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
933413290 2:81951500-81951522 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
933437693 2:82269431-82269453 GAGTCTATTCTGAAGCAGTGTGG - Intergenic
933880387 2:86663829-86663851 GAGGGTGGGCTGAAGCAGGGTGG + Intronic
934314210 2:91901501-91901523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934617034 2:95778617-95778639 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
934643859 2:96045942-96045964 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
934702656 2:96454572-96454594 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934734581 2:96683451-96683473 GAGGTCATACTGGAGCAGGGTGG - Intergenic
934837276 2:97602036-97602058 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
935273976 2:101460215-101460237 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
935325750 2:101935514-101935536 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
935982724 2:108643343-108643365 GAGGATGAGCCGAAGCAGGGTGG + Intronic
936093564 2:109515772-109515794 GAGGCAAAAGTGGAGCAGGAGGG + Intergenic
936448409 2:112615193-112615215 GAGGCTGAGCGGAAGCAGGGTGG - Intergenic
936649910 2:114413974-114413996 GAGGGTAAGCCAAAGCAGGGAGG - Intergenic
936859578 2:117001291-117001313 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
936909842 2:117579381-117579403 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
937000054 2:118457577-118457599 GAGGGCAAGCTGAAGCAGGGGGG - Intergenic
937143047 2:119618432-119618454 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
937453870 2:122024920-122024942 GAGGCTAAACTGCTGTGGGGGGG + Intergenic
937465104 2:122125442-122125464 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
937606225 2:123804544-123804566 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
938067953 2:128292101-128292123 GAGGGTGAACTGAGGCCGGGGGG + Intronic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938263820 2:129912505-129912527 GAAGTTAAACTGAAGCAGAGTGG + Intergenic
939055510 2:137360385-137360407 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939652721 2:144785121-144785143 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
939744512 2:145952173-145952195 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940417899 2:153443343-153443365 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940644478 2:156376226-156376248 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940964436 2:159821883-159821905 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941294195 2:163715503-163715525 GCGGCTGGAGTGAAGCAGGGTGG - Intronic
941518799 2:166511843-166511865 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
941523746 2:166581365-166581387 GAGGGCAAGCTGAAACAGGGCGG + Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
941896053 2:170630078-170630100 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
942410952 2:175708960-175708982 GAGGGTGAACTGAAGCCGGGTGG + Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942434594 2:175957729-175957751 GACGATGAGCTGAAGCAGGGCGG + Intronic
942744071 2:179212168-179212190 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
942854831 2:180532560-180532582 GAGTGTAAGCTGAAGCAGGGCGG - Intergenic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
943352438 2:186811911-186811933 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
943552576 2:189358020-189358042 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
943660399 2:190554009-190554031 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
943716741 2:191160715-191160737 GAGGACAAGCCGAAGCAGGGTGG + Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944374729 2:199028621-199028643 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
944635321 2:201670904-201670926 AAGGGTAAACCAAAGCAGGGTGG + Intronic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
945056466 2:205873596-205873618 GTGGCAAGACTGGAGCAGGGAGG + Intergenic
945116800 2:206416045-206416067 GAGGGCAAGCCGAAGCAGGGCGG - Intergenic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945566644 2:211409267-211409289 AAGGCAAAAATGAAGCAGAGAGG - Intronic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
945945125 2:215988240-215988262 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
946109744 2:217404128-217404150 GAGACTCAACTGGAGGAGGGAGG - Intronic
946794029 2:223330655-223330677 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947275876 2:228391217-228391239 GAGGGCAAGCTGAAGCAGGGGGG - Intergenic
947537414 2:230948977-230948999 GAGGATAATCTGAGCCAGGGGGG + Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
949046324 2:241874138-241874160 GAGGCTACACTGAGGCTGGAGGG - Intergenic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1171081795 20:22194276-22194298 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1171428124 20:25061245-25061267 GAGGGTACACTGGATCAGGGAGG - Intergenic
1172183912 20:33019801-33019823 GAGGGGACAGTGAAGCAGGGAGG - Intronic
1172435699 20:34927516-34927538 GGGCCTCCACTGAAGCAGGGAGG + Exonic
1172456334 20:35077229-35077251 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1172466688 20:35160788-35160810 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1173771843 20:45666395-45666417 GAGGGTGAGCGGAAGCAGGGTGG - Intronic
1174224117 20:48982968-48982990 TAGGGTGAGCTGAAGCAGGGCGG - Intronic
1175778872 20:61669564-61669586 GAAGGAAAACTGAAGAAGGGTGG + Intronic
1175913964 20:62417104-62417126 CAGGATAAACTGAACCAGGAAGG - Intronic
1176116530 20:63434062-63434084 GAGGGTAAACTGAGGCTGTGGGG - Intronic
1176716617 21:10355679-10355701 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1177087638 21:16727192-16727214 GAGGGTAAAGTGAAGTACGGTGG - Intergenic
1177111463 21:17034280-17034302 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1177184275 21:17776037-17776059 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1177352882 21:19967699-19967721 GAGGTCATACTGAAGTAGGGTGG + Intergenic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179424110 21:41259919-41259941 GAGGATCACCTGAACCAGGGAGG - Intronic
1179997530 21:44980924-44980946 GAGGCCACACTGGAGCAGGGAGG - Intergenic
1180219764 21:46351094-46351116 GACCCTAAACCGAAGCAGGGAGG + Intronic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180596152 22:16974857-16974879 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1180601719 22:17024257-17024279 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1181109185 22:20591411-20591433 GAGCCTCTGCTGAAGCAGGGAGG + Intergenic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181766222 22:25094201-25094223 GTGGTTAAACGGGAGCAGGGAGG + Intronic
1182057727 22:27373196-27373218 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1182624185 22:31634050-31634072 GTGGCTTGACTGAGGCAGGGAGG - Intronic
1183021574 22:35031241-35031263 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1183646454 22:39129886-39129908 GAGGCTAGGCTGGAGCAGGCAGG - Intronic
1183736238 22:39646393-39646415 GAGGCAGAAATGAAGCAAGGAGG - Intronic
1184208856 22:43023510-43023532 GAGGCTCAGCAGAAGAAGGGGGG - Intergenic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184660109 22:45961718-45961740 GATGGGAAACTGAGGCAGGGAGG - Intronic
1184843087 22:47063933-47063955 GAGGCCACACTGGAGTAGGGGGG - Intronic
1184843107 22:47064023-47064045 GAGGCCACACTGGAGTAGGGGGG - Intronic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949428176 3:3941855-3941877 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949488481 3:4564441-4564463 GAGGCCATACTGGAGCGGGGTGG - Intronic
949580682 3:5384534-5384556 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949801281 3:7906631-7906653 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
949803966 3:7934332-7934354 GAGGACAAGCTGAAGCAGGGCGG + Intergenic
949881757 3:8666814-8666836 GAGGCCAACTTGAAGCAGGTTGG - Intronic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950704505 3:14771594-14771616 GAGGCCATACTGGAGGAGGGTGG - Intronic
950738927 3:15034189-15034211 GATCCGAGACTGAAGCAGGGAGG - Intronic
950888768 3:16384476-16384498 GAGGCTGAAGTGTGGCAGGGAGG + Intronic
950953287 3:17023989-17024011 GAGGATGAACTGCAGCAGAGAGG - Intronic
951006261 3:17618873-17618895 GAGGGTGAGCTGAAGCAAGGCGG - Intronic
951012118 3:17693254-17693276 GAAGGCAAGCTGAAGCAGGGTGG + Intronic
951310820 3:21124694-21124716 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
951368256 3:21812372-21812394 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
951984742 3:28606310-28606332 GAGTCTATAGTGAAGCAGGGTGG + Intergenic
952517730 3:34122560-34122582 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
953047153 3:39304373-39304395 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953219097 3:40951243-40951265 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
953653157 3:44823984-44824006 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
953711570 3:45275569-45275591 GATGCAATGCTGAAGCAGGGAGG + Intergenic
954006541 3:47595822-47595844 GAGACTCACCTGAACCAGGGAGG - Intronic
954501035 3:51014137-51014159 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
954507566 3:51091852-51091874 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
954827905 3:53391297-53391319 GAGGATGAGCTGAAACAGGGTGG + Intergenic
955412071 3:58662119-58662141 GAGGACAAACTGGATCAGGGTGG + Intronic
955527192 3:59833283-59833305 GAGGCCATACTGAAATAGGGTGG + Intronic
955657918 3:61264111-61264133 GAGGGTGAGATGAAGCAGGGTGG - Intergenic
955808494 3:62761636-62761658 GAAACTAAAATCAAGCAGGGAGG + Intronic
956048384 3:65220701-65220723 GAGGATGAGCGGAAGCAGGGTGG - Intergenic
956207803 3:66772117-66772139 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956373287 3:68587116-68587138 GAGGGTGAGCTGAAGCAAGGCGG - Intergenic
956874107 3:73445032-73445054 TAGGCTGAAGTGAAGCAGGAAGG + Intronic
957249578 3:77756590-77756612 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
958081073 3:88747058-88747080 GAGCACAAGCTGAAGCAGGGTGG + Intergenic
958257512 3:91341516-91341538 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
958414005 3:93852732-93852754 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
958434615 3:94081204-94081226 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
958479685 3:94630772-94630794 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
958618442 3:96526811-96526833 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
958694643 3:97511476-97511498 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
958706861 3:97666645-97666667 GAGGTCATACTGAAGTAGGGTGG - Intronic
958975959 3:100668079-100668101 GAGGGAGAGCTGAAGCAGGGTGG - Intronic
959045254 3:101466855-101466877 GAGGGCAAGCTGAAGCAGGGCGG + Intronic
959059814 3:101605780-101605802 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
959093157 3:101925334-101925356 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
959116496 3:102184469-102184491 GAGGGTAAACTGAGGCAAGTGGG + Intronic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959494869 3:107038496-107038518 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
959734897 3:109647734-109647756 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
959736433 3:109664888-109664910 GAGGGTGTGCTGAAGCAGGGCGG + Intergenic
959815753 3:110671581-110671603 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
959847993 3:111056503-111056525 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
960226988 3:115179908-115179930 GAGGGTAAGCCAAAGCAGGGTGG - Intergenic
960653888 3:119981368-119981390 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
960763401 3:121097609-121097631 GAGGGTGATCTGAAGCAGGGTGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960787732 3:121392375-121392397 GAGAGTGAGCTGAAGCAGGGTGG - Intronic
960836098 3:121908354-121908376 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
961007237 3:123413278-123413300 AACCCTAAACTGAAGCAGGCAGG + Intronic
961984890 3:131121950-131121972 GAGCGTGAGCTGAAGCAGGGCGG - Intronic
961998324 3:131269524-131269546 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962494117 3:135922392-135922414 GAGGATCAACTGAGCCAGGGAGG + Intergenic
962512258 3:136114111-136114133 GAGGGTGACCCGAAGCAGGGTGG + Intronic
962675144 3:137750846-137750868 GAGAGTGAGCTGAAGCAGGGCGG + Intergenic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963306816 3:143662475-143662497 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
963410933 3:144926793-144926815 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963898584 3:150711981-150712003 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
963980150 3:151528549-151528571 GAGGGCAAACCAAAGCAGGGTGG + Intergenic
963998639 3:151740288-151740310 GAGGGCGAACAGAAGCAGGGTGG - Intronic
964371447 3:156004381-156004403 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964649188 3:158991866-158991888 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
966255005 3:177907976-177907998 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
966351758 3:179038732-179038754 GAGGACGAACTGAAGCAGGGTGG + Intronic
966638000 3:182157002-182157024 GAGGGCAAGCTGAAGCAAGGTGG - Intergenic
967244936 3:187477172-187477194 GAGGACAACCCGAAGCAGGGAGG - Intergenic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967756823 3:193179532-193179554 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
968376078 4:42519-42541 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
968408658 4:365303-365325 GAGGGCAAGCTGAAACAGGGTGG - Intronic
968802097 4:2749874-2749896 GAGGCTACAGTGAACCATGGTGG - Intronic
968860693 4:3166911-3166933 GAGGGCAAGCCGAAGCAGGGCGG - Intronic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
970939685 4:21616796-21616818 GAGGCCATACTGAAGTAGGATGG - Intronic
970975766 4:22041160-22041182 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
970992238 4:22225664-22225686 GAGGCCATACTGGAGTAGGGTGG + Intergenic
971151181 4:24033201-24033223 AAGAGGAAACTGAAGCAGGGAGG - Intergenic
971437204 4:26640577-26640599 GAGGGTGAGCCGAAGCAGGGAGG + Intronic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972743362 4:41909810-41909832 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
972755477 4:42041904-42041926 GAGGGTGACCCGAAGCAGGGTGG + Intronic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973272920 4:48279759-48279781 GAGGGTGAGCTGAAGCAAGGTGG + Intergenic
973626118 4:52774128-52774150 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973715303 4:53670108-53670130 GAGGGCAAACTGAAGCAGCGTGG - Intronic
973798307 4:54451044-54451066 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
973835718 4:54807218-54807240 GAGGGTGAATTGAAGCAGGGTGG + Intergenic
973871381 4:55170081-55170103 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
973883501 4:55297300-55297322 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
974265823 4:59584541-59584563 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
974566865 4:63589749-63589771 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
974792924 4:66713738-66713760 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
974944108 4:68505335-68505357 GAAGGCAAGCTGAAGCAGGGTGG - Intergenic
975076332 4:70213192-70213214 GAGCATGAGCTGAAGCAGGGCGG - Intergenic
975149506 4:71005260-71005282 GAGGCCAAGCAGAAGCAGGGTGG - Intronic
975245778 4:72119624-72119646 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
975291152 4:72679481-72679503 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
975305828 4:72847809-72847831 GAGTGTGAGCTGAAGCAGGGAGG + Intergenic
975318168 4:72978995-72979017 GAGGATATACTGAAGTAGGGTGG + Intergenic
975350503 4:73340340-73340362 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
975425050 4:74215491-74215513 GAGGGCGAACTGAAGCAGGGTGG - Intronic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975528698 4:75378372-75378394 GAGTGTGAACCGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975751144 4:77524692-77524714 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
975753623 4:77550313-77550335 GAGTGTAAGATGAAGCAGGGTGG - Intronic
975844066 4:78506723-78506745 GAGGGCAAGCTGAAGCAGGGAGG - Intronic
976061350 4:81131281-81131303 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
976169771 4:82291146-82291168 GAGGATCAACTGAGCCAGGGAGG + Intergenic
976394823 4:84544798-84544820 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
976506509 4:85853448-85853470 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
976534412 4:86194042-86194064 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
976585337 4:86791014-86791036 GAGGGTGGGCTGAAGCAGGGTGG + Intronic
977057382 4:92211006-92211028 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
977203899 4:94148499-94148521 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
977219836 4:94325755-94325777 GAGGGCAAGCTGAAGCAGTGTGG - Intronic
977326517 4:95580771-95580793 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
977561431 4:98537286-98537308 GAGGGCAAGCCGAAGCAGGGTGG - Intronic
977771756 4:100868776-100868798 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
977946429 4:102919579-102919601 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
978108190 4:104930405-104930427 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
978110780 4:104961745-104961767 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
978138986 4:105296790-105296812 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
978464498 4:108994126-108994148 GAGGGCTACCTGAAGCAGGGAGG + Intronic
978906712 4:114013466-114013488 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
979115199 4:116814962-116814984 GAGGGTGATCCGAAGCAGGGTGG + Intergenic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979487465 4:121284957-121284979 GAGGGTAAGCTGAGGCAGAGTGG + Intergenic
979751821 4:124288621-124288643 GTGTCTAAACTGAAAAAGGGAGG - Intergenic
979966070 4:127077635-127077657 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
980100405 4:128536176-128536198 GAGGGTGAACCAAAGCAGGGTGG - Intergenic
980148679 4:129021099-129021121 GAGGATGAACAGAAGTAGGGTGG + Intronic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980583722 4:134786901-134786923 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
980584005 4:134789394-134789416 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981629622 4:146804092-146804114 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
981671455 4:147292316-147292338 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
981749770 4:148082410-148082432 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
981788065 4:148503165-148503187 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
981796336 4:148599270-148599292 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
981859932 4:149341829-149341851 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
981939843 4:150271052-150271074 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
982260363 4:153488985-153489007 GAGGCTGGACTGGAGTAGGGTGG - Intronic
982323790 4:154108627-154108649 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982853044 4:160342772-160342794 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982909302 4:161118542-161118564 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983388112 4:167092138-167092160 GAGGGCAAGCTGAAGTAGGGTGG + Intronic
983594264 4:169448827-169448849 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
983602834 4:169549253-169549275 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
983787974 4:171758976-171758998 GAGGGTGAGTTGAAGCAGGGTGG + Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984224390 4:177017357-177017379 GAGGGTGAACCGAAGCAGGGCGG + Intergenic
984263493 4:177470044-177470066 GAGACTCACCTGAACCAGGGAGG - Intergenic
984372383 4:178884070-178884092 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
984434069 4:179685648-179685670 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
984450098 4:179888686-179888708 GAGAATAAATTGAACCAGGGAGG + Intergenic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
985794734 5:1953580-1953602 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
986838892 5:11672901-11672923 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
988360581 5:30231687-30231709 GGGGCTAAAGTGAGGCAGTGGGG - Intergenic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988771177 5:34434754-34434776 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
988795152 5:34646674-34646696 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
988867776 5:35354339-35354361 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
988975143 5:36508164-36508186 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
989001192 5:36762582-36762604 GAGGTCATACTGGAGCAGGGTGG - Intergenic
989345331 5:40423184-40423206 GAGGATGAGCCGAAGCAGGGCGG - Intergenic
989349957 5:40474727-40474749 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989522504 5:42418395-42418417 GAGAATAAGCTGAAGCAGGGTGG - Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
990053029 5:51531485-51531507 TAGGCTAAACTGCAGCTGGTTGG + Intergenic
990239153 5:53799519-53799541 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
990244922 5:53854670-53854692 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
990713065 5:58606070-58606092 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
991034496 5:62114593-62114615 GAGGCTAAACAGAAGGAATGTGG - Intergenic
991105411 5:62837237-62837259 GAGGGTGAGCTGAAGCACGGTGG + Intergenic
991151422 5:63375836-63375858 GAGGGGGAGCTGAAGCAGGGTGG + Intergenic
991236617 5:64406809-64406831 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
991280811 5:64910924-64910946 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
991575806 5:68102374-68102396 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
992025992 5:72669619-72669641 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992254971 5:74912065-74912087 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
993081189 5:83302486-83302508 GAGGGAGAGCTGAAGCAGGGTGG - Intronic
993266402 5:85732009-85732031 GAGGGCAAACCAAAGCAGGGTGG + Intergenic
993366755 5:87042993-87043015 GAGGGTGAGCTGAAGCAGGTCGG - Intergenic
993546568 5:89220051-89220073 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
993757712 5:91751497-91751519 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
993888243 5:93442217-93442239 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
993948055 5:94138420-94138442 GAGGGTAAGCCAAAGCAGGGCGG - Intergenic
994005247 5:94829263-94829285 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994138039 5:96309748-96309770 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
994142945 5:96361627-96361649 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
994350230 5:98737357-98737379 GAGCATAAGCTGAAGCAGGGTGG + Intergenic
994377991 5:99037453-99037475 GAGGGTGAGCTGAAGCAAGGTGG + Intergenic
994558721 5:101339047-101339069 AAGGCCAAAGTGAAGCAGGCTGG + Intergenic
994622551 5:102179803-102179825 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
994636533 5:102351462-102351484 GAAGGTGAGCTGAAGCAGGGCGG + Intergenic
994641872 5:102420963-102420985 GAGGCCGAGCAGAAGCAGGGTGG + Intronic
995093990 5:108213583-108213605 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995643014 5:114278841-114278863 GAGGGTGAGCTGAAGTAGGGCGG - Intergenic
995906652 5:117132250-117132272 GAGGCTACACTGGAGTTGGGTGG - Intergenic
996096061 5:119400425-119400447 GAAGTCAAACTGAAACAGGGAGG + Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996477831 5:123941541-123941563 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
997002698 5:129781514-129781536 GAAATTAAACTGAATCAGGGAGG - Intergenic
997220442 5:132157658-132157680 GAGGGCGACCTGAAGCAGGGTGG - Intergenic
997343934 5:133171198-133171220 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
997434419 5:133864154-133864176 GAGGCTAAGCTGACACAGTGTGG + Intergenic
997520518 5:134521207-134521229 GAGGCAAAGCTGAAGCAGGAAGG - Intergenic
997634103 5:135391825-135391847 GAGGCTGAACCAACGCAGGGAGG - Intronic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
997989913 5:138535783-138535805 GAGGCTGAGCTGAACCTGGGAGG + Intronic
998691905 5:144596290-144596312 GAGGGTGAACCGAAGCAGGGTGG - Intergenic
998772746 5:145564948-145564970 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
1000214250 5:159139692-159139714 GAGGGTAAGCCAAAGCAGGGCGG + Intergenic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1000591040 5:163157720-163157742 GGTGCCAAACTGAACCAGGGAGG + Intergenic
1000591574 5:163165196-163165218 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1000858864 5:166432727-166432749 GTGCCTAAAGTGTAGCAGGGTGG - Intergenic
1000996186 5:167960994-167961016 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1001722871 5:173870807-173870829 GAGGCTGAAGAGCAGCAGGGAGG + Intergenic
1002944713 6:1750428-1750450 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1003016631 6:2473244-2473266 GAGGCCATACTGGAGTAGGGTGG + Intergenic
1003165915 6:3678147-3678169 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1003434444 6:6072715-6072737 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
1003647463 6:7925842-7925864 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1003713590 6:8620090-8620112 GAGGGTTAGCCGAAGCAGGGTGG - Intergenic
1003804741 6:9714302-9714324 GAGGCCATACTGGAGTAGGGTGG - Intronic
1003970973 6:11299010-11299032 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1004220359 6:13741736-13741758 GAGGTCATACTGAAGCAGGGAGG - Intergenic
1004621831 6:17337395-17337417 GAGGATCACCTGAACCAGGGAGG + Intergenic
1005747093 6:28848590-28848612 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1006198466 6:32263590-32263612 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1006491942 6:34395105-34395127 GAGGCTTAACTAAAGGAGGCTGG + Intronic
1007273373 6:40655621-40655643 GATGCTCAGCTGAAGCAGGGAGG + Intergenic
1007508944 6:42360733-42360755 GAGGATGAACTGACCCAGGGAGG + Intronic
1007858049 6:44878770-44878792 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1008209474 6:48703112-48703134 GATGCCAAACTGAAGGTGGGAGG + Intergenic
1008575558 6:52856853-52856875 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1008782813 6:55127367-55127389 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1008865334 6:56203812-56203834 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1008997793 6:57679507-57679529 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1009186285 6:60578845-60578867 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009290009 6:61869703-61869725 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1009628622 6:66166650-66166672 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1009795143 6:68456535-68456557 GAGGGTGAACCAAAGCAGGGTGG - Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1009998202 6:70920394-70920416 GAGGGCAAGCCGAAGCAGGGCGG - Intronic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1010006148 6:70997839-70997861 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1010039235 6:71361627-71361649 GAGGGCAAGCTGAAGCAAGGTGG - Intergenic
1010171862 6:72984683-72984705 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010422186 6:75688366-75688388 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010447080 6:75960165-75960187 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1010522139 6:76850254-76850276 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010671699 6:78694469-78694491 GAGCATGAGCTGAAGCAGGGCGG + Intergenic
1010676938 6:78756269-78756291 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1010747205 6:79577793-79577815 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1010755724 6:79664138-79664160 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1010961486 6:82151063-82151085 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011086439 6:83546490-83546512 GAAGGCGAACTGAAGCAGGGTGG + Intergenic
1011137489 6:84115874-84115896 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1011174017 6:84540651-84540673 GACGGCAAGCTGAAGCAGGGTGG + Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011348016 6:86392744-86392766 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011417700 6:87139829-87139851 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011578107 6:88827235-88827257 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1011741893 6:90369908-90369930 GAGGCCATACTGGAGCAGAGTGG - Intergenic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012207548 6:96479190-96479212 GAGGGTGAACTGAAGCAAGGTGG - Intergenic
1012484136 6:99702270-99702292 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1012585289 6:100914105-100914127 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1012725908 6:102809418-102809440 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
1012940965 6:105415153-105415175 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1013625759 6:111935254-111935276 GAGGCTGAGCTGAAGCAGTGTGG - Intergenic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013815772 6:114095529-114095551 GCGATTTAACTGAAGCAGGGTGG + Intronic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014122798 6:117745870-117745892 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1014422906 6:121267294-121267316 GAGTGTGAACCGAAGCAGGGCGG + Intronic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1014922347 6:127228332-127228354 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1015419158 6:132986442-132986464 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1015623484 6:135156631-135156653 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1015801994 6:137069979-137070001 GAGGGTGAGCTGAAACAGGGTGG + Intergenic
1015978423 6:138814769-138814791 GAGGCTGAAGTGAAGCCGTGGGG + Intronic
1016006046 6:139090401-139090423 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1016334839 6:142993891-142993913 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1016436919 6:144047169-144047191 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1016542084 6:145177792-145177814 GAGGGTGAGCTGAAACAGGGTGG + Intergenic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1018003857 6:159602571-159602593 GAGACTAAACAAGAGCAGGGAGG + Intergenic
1018094601 6:160374302-160374324 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1018114722 6:160572170-160572192 GAGGGTGACCTGAAGCAGGGTGG - Intronic
1018175837 6:161178595-161178617 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1018576332 6:165263797-165263819 GAGGCCAAGCTGAACCAGGCAGG + Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019969439 7:4528323-4528345 GAGGTCAAACTGAACCAGAGAGG - Intergenic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020609049 7:10372700-10372722 GAGGGCAAGCTGAAGTAGGGAGG + Intergenic
1020693960 7:11392240-11392262 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021014579 7:15517511-15517533 GAGGCCAAGCAGAAGCAGGGTGG + Intronic
1021167100 7:17354752-17354774 GAGGGCAAGCTGAAACAGGGTGG - Intergenic
1021207772 7:17806802-17806824 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1021306674 7:19040220-19040242 GAGGGCTAGCTGAAGCAGGGTGG - Intronic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021782350 7:24118410-24118432 GAAGGCAAGCTGAAGCAGGGTGG - Intergenic
1021997050 7:26189297-26189319 GAGGGTTTACTGAAGCATGGGGG - Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022136069 7:27449518-27449540 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1022653001 7:32294117-32294139 GAGGCTAAGCTGAAGGGAGGAGG - Intronic
1023024157 7:36035859-36035881 GGGGCAAAACTGCAGCAGAGTGG + Intergenic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023892006 7:44399555-44399577 GAGGATAAAATGAAGATGGGTGG - Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024372968 7:48607339-48607361 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1024534468 7:50418616-50418638 GAAGCTCAACTGAGACAGGGAGG - Intergenic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1024950590 7:54856321-54856343 GAGGGTGAACAGAAGCAGTGTGG - Intergenic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1027510407 7:79072087-79072109 GAGGGCAAGCTGAAGCAGAGTGG - Intronic
1027790311 7:82633242-82633264 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1027864656 7:83630081-83630103 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1028013635 7:85679804-85679826 GAGGGTGAGCTGAAACAGGGCGG - Intergenic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028080266 7:86567202-86567224 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1028396072 7:90369791-90369813 GAGGGCAAACCAAAGCAGGGTGG - Intronic
1028476416 7:91258172-91258194 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1028630086 7:92925197-92925219 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1028648122 7:93120714-93120736 GAGGGTGAGCTGAAGCTGGGTGG + Intergenic
1028692094 7:93664008-93664030 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1029845335 7:103406476-103406498 GAGGGCAAGCTGAACCAGGGTGG - Intronic
1029884668 7:103855851-103855873 GAGGTTATACTGGAGTAGGGTGG - Intronic
1030450246 7:109700084-109700106 GTGGCTAAAATAAAGCAGGGAGG + Intergenic
1030500898 7:110357078-110357100 GAGGATGAACAAAAGCAGGGTGG - Intergenic
1030533952 7:110743633-110743655 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1030612720 7:111706489-111706511 GAGGGTGAGCTGAAGCAGGTTGG - Intergenic
1030703166 7:112662857-112662879 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1031031752 7:116743080-116743102 GAGGTTGAGCTGAAGCAAGGTGG + Intronic
1031407819 7:121406978-121407000 GACACTAGACTCAAGCAGGGAGG - Intergenic
1031520144 7:122754564-122754586 GAGACTCAACTGAACCTGGGAGG - Intronic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1032312668 7:130802820-130802842 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1033887493 7:145966733-145966755 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1034015882 7:147586033-147586055 AAGGTGAAACTGAAGCAGGAAGG + Intronic
1034083049 7:148298467-148298489 GTGGCTAGAATAAAGCAGGGAGG - Intronic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034715192 7:153235290-153235312 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1034986003 7:155515733-155515755 GAGGCTTCTCTGCAGCAGGGAGG + Intronic
1034988061 7:155529689-155529711 GAGGTCATACTGGAGCAGGGTGG - Intronic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036476179 8:9095608-9095630 GAGGATCACCTGAAGCAGGGAGG - Intronic
1036575866 8:10027237-10027259 GAGGTCACACTGGAGCAGGGTGG - Intergenic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037557679 8:20041289-20041311 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1037578909 8:20233136-20233158 GAGGTCACACTGAAGTAGGGTGG + Intergenic
1037626059 8:20607932-20607954 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1038500218 8:28037538-28037560 GAGGCAACAGTGAAGCAGGAGGG - Intronic
1039145110 8:34438440-34438462 GAGGGCAAGCTGAAGCAGCGTGG + Intergenic
1039154045 8:34535545-34535567 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039347662 8:36725903-36725925 AAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1039680916 8:39735501-39735523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1039754911 8:40512728-40512750 GAGAACAAGCTGAAGCAGGGTGG - Intergenic
1039832336 8:41225149-41225171 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1040354929 8:46608294-46608316 GAGGGAGAGCTGAAGCAGGGTGG + Intergenic
1040473012 8:47752132-47752154 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1040556665 8:48485727-48485749 GAGGGCAAGCTGAAGCTGGGTGG + Intergenic
1040779815 8:51094823-51094845 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041022358 8:53650623-53650645 GAGGCTAACAGGAAGCAGAGTGG - Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041198748 8:55428693-55428715 GACTCTACACTGAAGTAGGGGGG - Intronic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041634793 8:60130635-60130657 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1041944273 8:63424215-63424237 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1041997661 8:64083819-64083841 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1042308758 8:67358915-67358937 GAGGGCGATCTGAAGCAGGGCGG - Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1042614295 8:70631862-70631884 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1042946110 8:74156350-74156372 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043048818 8:75359823-75359845 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1043165883 8:76902067-76902089 GAGGGCAAGCGGAAGCAGGGTGG - Intergenic
1043244442 8:77979698-77979720 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043605180 8:81991078-81991100 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044503477 8:92990598-92990620 GAGGGCAAGCTGAAGCAGCGTGG + Intronic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044577010 8:93780341-93780363 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044956651 8:97488121-97488143 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1045088161 8:98710318-98710340 GAGCATGAGCTGAAGCAGGGCGG + Intronic
1045123365 8:99063241-99063263 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045484670 8:102621758-102621780 GGGGCTAATCTGAGGCAGTGAGG + Intergenic
1045597741 8:103675413-103675435 GAGGCAAAACTGGACCAGGGAGG + Intronic
1045646980 8:104308735-104308757 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045797655 8:106065101-106065123 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045802529 8:106117936-106117958 GAGTGTGAACTGAAGCAGGGTGG - Intergenic
1045975185 8:108123321-108123343 GAGGGAGAGCTGAAGCAGGGTGG - Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046295781 8:112217972-112217994 GAGGGTGAACAGAACCAGGGTGG + Intergenic
1046312573 8:112457679-112457701 GAGGCTAAAATGAAGCATTTAGG + Intronic
1046879257 8:119290291-119290313 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1046880868 8:119306947-119306969 AAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1046900745 8:119521145-119521167 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1047129319 8:122001413-122001435 GAGGGCAAGCTGAAGCAAGGCGG + Intergenic
1047133600 8:122051216-122051238 GAGGGTGAACTGAAGCACGGTGG + Intergenic
1047931513 8:129732831-129732853 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1047971396 8:130087571-130087593 GAGGCTAATGTGCTGCAGGGAGG + Intronic
1048973073 8:139655998-139656020 GAGGCTAGAGGCAAGCAGGGCGG + Intronic
1049242077 8:141543174-141543196 GAGGCCATACTGGAGTAGGGTGG + Intergenic
1050234474 9:3563176-3563198 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1050386958 9:5101052-5101074 GAGGGCAAGTTGAAGCAGGGCGG + Intronic
1050591115 9:7161302-7161324 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1050597263 9:7216405-7216427 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1050604200 9:7283676-7283698 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1050645274 9:7713072-7713094 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1051112165 9:13651411-13651433 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1051124767 9:13791687-13791709 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1051308766 9:15746771-15746793 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051863472 9:21652146-21652168 GAGGAGGAGCTGAAGCAGGGTGG - Intergenic
1052052800 9:23866893-23866915 GAGGGTAAGCCAAAGCAGGGTGG - Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052146992 9:25061627-25061649 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1052217288 9:25982668-25982690 CAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1052329287 9:27251328-27251350 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1052668091 9:31519659-31519681 GAGGTCAAGCCGAAGCAGGGTGG - Intergenic
1052852787 9:33387917-33387939 GCGGCCTGACTGAAGCAGGGAGG - Intronic
1052887692 9:33666172-33666194 GAGGGTGAGCTGAACCAGGGCGG + Intergenic
1054887304 9:70212592-70212614 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1054979353 9:71186177-71186199 GAGGCCATACTGGAGCAGGATGG - Intronic
1055032246 9:71782436-71782458 GTGGCAAAACTGAAGCACAGAGG - Intronic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055642881 9:78334481-78334503 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1056997864 9:91479948-91479970 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1057395983 9:94680805-94680827 GAGGTTATACTGGAGGAGGGAGG + Intergenic
1058074664 9:100638266-100638288 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1058203035 9:102067153-102067175 GAAGGTGAGCTGAAGCAGGGCGG - Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058757302 9:108095221-108095243 GAGGATCAAATGAAGCACGGAGG - Intergenic
1059207912 9:112483828-112483850 GAGGATCGACTGAGGCAGGGAGG + Intronic
1059297373 9:113283588-113283610 GCAGCTCAACTTAAGCAGGGAGG - Intronic
1059864712 9:118501486-118501508 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1060050945 9:120377717-120377739 GAGGTCATACTGGAGCAGGGTGG - Intergenic
1060083666 9:120677216-120677238 GAGGATAACCTGAGGCAAGGAGG - Intronic
1060615231 9:125007027-125007049 GAGAATCAACTGAACCAGGGAGG + Intronic
1060821099 9:126661966-126661988 GAGGCGGAACTGCAGCAGGAAGG + Intronic
1061499537 9:130993977-130993999 TAGCCTAAACAGGAGCAGGGAGG - Intergenic
1061552430 9:131345363-131345385 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1061559146 9:131391718-131391740 GAGGCTGAACAGTAACAGGGTGG - Intergenic
1061598046 9:131645384-131645406 GTGGCTAATCTGAAGATGGGAGG + Intronic
1203573148 Un_KI270744v1:151631-151653 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1185595760 X:1305743-1305765 CAGGAGAAACTGAGGCAGGGTGG + Intronic
1185766919 X:2732974-2732996 GAGGAAGAAGTGAAGCAGGGAGG - Intronic
1185911061 X:3981847-3981869 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1186370094 X:8937687-8937709 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1186981100 X:14958367-14958389 GAGGTCATACTGGAGCAGGGTGG + Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187705457 X:22005425-22005447 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1187829207 X:23363625-23363647 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
1187840019 X:23477200-23477222 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1187899890 X:24017689-24017711 GAGGATAAACTGAGCCCGGGAGG + Intronic
1188123054 X:26334150-26334172 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188954610 X:36418835-36418857 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189002957 X:36964477-36964499 GAGGCTTACCTGAACCCGGGAGG - Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1189575190 X:42343666-42343688 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189754051 X:44252977-44252999 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1189978506 X:46486361-46486383 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1190648999 X:52550908-52550930 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1190683451 X:52849531-52849553 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191003836 X:55689100-55689122 GAGGGTAAGCCGAAGCAGGGTGG - Intergenic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191073762 X:56430051-56430073 GAGGGTGAGCTAAAGCAGGGCGG - Intergenic
1191079635 X:56495421-56495443 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191181126 X:57565077-57565099 GATGCCAAGCTGAAGCAGGACGG + Intergenic
1191237819 X:58150496-58150518 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191645621 X:63478164-63478186 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191686658 X:63899282-63899304 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1191733441 X:64363760-64363782 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1191793699 X:64999287-64999309 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1191873016 X:65765674-65765696 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1191882455 X:65856630-65856652 GAGGGTGAGCTGAAGCAGGGAGG - Intergenic
1191907443 X:66108279-66108301 GAGGGTGAGGTGAAGCAGGGTGG - Intergenic
1191941756 X:66489041-66489063 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191984762 X:66968296-66968318 GAGGGTGAACCAAAGCAGGGTGG + Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192009176 X:67250062-67250084 GAAGGTGAACAGAAGCAGGGTGG + Intergenic
1192129063 X:68530761-68530783 GGGGGTGAGCTGAAGCAGGGTGG - Intronic
1192174694 X:68878410-68878432 GGAGCAAAACTGGAGCAGGGTGG - Intergenic
1192382454 X:70632517-70632539 GAGGATAAACTGAGCCTGGGAGG + Intronic
1192395851 X:70780478-70780500 GAGGGTGAACCAAAGCAGGGTGG + Intronic
1192524468 X:71829810-71829832 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1192598470 X:72437184-72437206 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1192727469 X:73768066-73768088 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192825879 X:74695860-74695882 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1192949176 X:75998100-75998122 GAGCATGAGCTGAAGCAGGGTGG - Intergenic
1192953251 X:76039897-76039919 GAGGGTGAACAGAAGCAGTGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192966632 X:76183566-76183588 GTGGGCAAACTGAAGCAAGGTGG - Intergenic
1192973804 X:76261477-76261499 GAGGGTGAACTGAGGCAAGGCGG - Intergenic
1192977364 X:76300314-76300336 GAGGCTGAGCTGAAGCAGGGTGG - Intergenic
1192999691 X:76550719-76550741 GAGGGTGAGATGAAGCAGGGTGG - Intergenic
1193013914 X:76710688-76710710 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193081670 X:77412335-77412357 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1193161454 X:78233352-78233374 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193266772 X:79481847-79481869 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
1193284702 X:79697581-79697603 GAGGGCAAGCTAAAGCAGGGTGG - Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193402567 X:81063841-81063863 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193435992 X:81475426-81475448 GAGGGCTAGCTGAAGCAGGGCGG - Intergenic
1193477202 X:81981601-81981623 GAGGGCAAGCTGAAGAAGGGTGG + Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194208586 X:91040470-91040492 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1194254791 X:91622625-91622647 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194355702 X:92881812-92881834 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194391082 X:93319272-93319294 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194837558 X:98699409-98699431 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1194959146 X:100215080-100215102 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1194963921 X:100266673-100266695 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1195097981 X:101524483-101524505 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195351272 X:103998711-103998733 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1195508228 X:105684203-105684225 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1195547297 X:106126817-106126839 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195842670 X:109191853-109191875 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1195947368 X:110229677-110229699 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1195994764 X:110720736-110720758 GTGTTTAAACTGAAGCAGGAAGG - Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196139639 X:112246691-112246713 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1196167513 X:112551732-112551754 GAGGGAGAACTGAAGCAGAGTGG - Intergenic
1196281265 X:113825811-113825833 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1196312301 X:114183328-114183350 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1196946678 X:120833355-120833377 CAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1197004166 X:121475185-121475207 GAGGGTGAGCTGAAGCATGGTGG - Intergenic
1197505917 X:127305663-127305685 GAGGGCGAACAGAAGCAGGGTGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197821182 X:130542396-130542418 GAGGCCATACTGGAGTAGGGTGG - Intergenic
1197906161 X:131428110-131428132 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1198002358 X:132451964-132451986 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1198085549 X:133278837-133278859 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1198293737 X:135263788-135263810 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1198571251 X:137959825-137959847 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1198592370 X:138198452-138198474 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1198678665 X:139157952-139157974 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199180952 X:144853792-144853814 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1199292304 X:146119007-146119029 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199383738 X:147200442-147200464 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199436528 X:147819213-147819235 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1199470979 X:148195791-148195813 GAAGCTAAAGTGAAAAAGGGAGG + Intergenic
1199939653 X:152612568-152612590 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1200182367 X:154158570-154158592 GAGGTCACACTGGAGCAGGGTGG - Intronic
1200188021 X:154195684-154195706 GAGGTCACACTGGAGCAGGGTGG - Intergenic
1200193671 X:154232824-154232846 GAGGTCACACTGGAGCAGGGTGG - Intronic
1200199426 X:154270628-154270650 GAGGTCACACTGGAGCAGGGTGG - Intronic
1200388581 X:155918603-155918625 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200573577 Y:4862228-4862250 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200664047 Y:5998794-5998816 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1200770348 Y:7119282-7119304 GAGGATAACCTGAACCTGGGAGG + Intergenic
1201353420 Y:13071772-13071794 GAGGGTGAGATGAAGCAGGGTGG + Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic