ID: 1072402985

View in Genome Browser
Species Human (GRCh38)
Location 10:95124618-95124640
Sequence ATAGGGAAGTAGAGAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072402978_1072402985 -6 Left 1072402978 10:95124601-95124623 CCCTTCCTAGATTAGGCATAGGG No data
Right 1072402985 10:95124618-95124640 ATAGGGAAGTAGAGAGGGAAGGG No data
1072402980_1072402985 -7 Left 1072402980 10:95124602-95124624 CCTTCCTAGATTAGGCATAGGGA No data
Right 1072402985 10:95124618-95124640 ATAGGGAAGTAGAGAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072402985 Original CRISPR ATAGGGAAGTAGAGAGGGAA GGG Intergenic
No off target data available for this crispr