ID: 1072407850

View in Genome Browser
Species Human (GRCh38)
Location 10:95171133-95171155
Sequence CACCCAGCACTGACAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072407843_1072407850 22 Left 1072407843 10:95171088-95171110 CCCTCTGAGACTTCTGTGTCCTG No data
Right 1072407850 10:95171133-95171155 CACCCAGCACTGACAGAACAAGG No data
1072407849_1072407850 -2 Left 1072407849 10:95171112-95171134 CCAAAAAATGGGCACTTGCGTCA No data
Right 1072407850 10:95171133-95171155 CACCCAGCACTGACAGAACAAGG No data
1072407844_1072407850 21 Left 1072407844 10:95171089-95171111 CCTCTGAGACTTCTGTGTCCTGG No data
Right 1072407850 10:95171133-95171155 CACCCAGCACTGACAGAACAAGG No data
1072407848_1072407850 3 Left 1072407848 10:95171107-95171129 CCTGGCCAAAAAATGGGCACTTG No data
Right 1072407850 10:95171133-95171155 CACCCAGCACTGACAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072407850 Original CRISPR CACCCAGCACTGACAGAACA AGG Intergenic
No off target data available for this crispr