ID: 1072408050

View in Genome Browser
Species Human (GRCh38)
Location 10:95173135-95173157
Sequence CAGTTCCTGTCCCATGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072408050_1072408055 -4 Left 1072408050 10:95173135-95173157 CCCTGGTCATGGGACAGGAACTG No data
Right 1072408055 10:95173154-95173176 ACTGTGGAGTCAGGACATTAGGG No data
1072408050_1072408059 19 Left 1072408050 10:95173135-95173157 CCCTGGTCATGGGACAGGAACTG No data
Right 1072408059 10:95173177-95173199 GGCTTCACCACCTGCAGAATGGG No data
1072408050_1072408061 27 Left 1072408050 10:95173135-95173157 CCCTGGTCATGGGACAGGAACTG No data
Right 1072408061 10:95173185-95173207 CACCTGCAGAATGGGAACAGAGG No data
1072408050_1072408054 -5 Left 1072408050 10:95173135-95173157 CCCTGGTCATGGGACAGGAACTG No data
Right 1072408054 10:95173153-95173175 AACTGTGGAGTCAGGACATTAGG No data
1072408050_1072408058 18 Left 1072408050 10:95173135-95173157 CCCTGGTCATGGGACAGGAACTG No data
Right 1072408058 10:95173176-95173198 GGGCTTCACCACCTGCAGAATGG No data
1072408050_1072408056 -3 Left 1072408050 10:95173135-95173157 CCCTGGTCATGGGACAGGAACTG No data
Right 1072408056 10:95173155-95173177 CTGTGGAGTCAGGACATTAGGGG No data
1072408050_1072408057 -2 Left 1072408050 10:95173135-95173157 CCCTGGTCATGGGACAGGAACTG No data
Right 1072408057 10:95173156-95173178 TGTGGAGTCAGGACATTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072408050 Original CRISPR CAGTTCCTGTCCCATGACCA GGG (reversed) Intergenic