ID: 1072409520

View in Genome Browser
Species Human (GRCh38)
Location 10:95187126-95187148
Sequence CTCCATAGGTATCTGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072409520_1072409528 3 Left 1072409520 10:95187126-95187148 CCATGGCCCAGATACCTATGGAG No data
Right 1072409528 10:95187152-95187174 TCTGGAAAGGTCCAGTGTTCAGG No data
1072409520_1072409530 22 Left 1072409520 10:95187126-95187148 CCATGGCCCAGATACCTATGGAG No data
Right 1072409530 10:95187171-95187193 CAGGAACAACCCTATCATTTAGG No data
1072409520_1072409526 -10 Left 1072409520 10:95187126-95187148 CCATGGCCCAGATACCTATGGAG No data
Right 1072409526 10:95187139-95187161 ACCTATGGAGGGATCTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072409520 Original CRISPR CTCCATAGGTATCTGGGCCA TGG (reversed) Intergenic
No off target data available for this crispr