ID: 1072411265

View in Genome Browser
Species Human (GRCh38)
Location 10:95204069-95204091
Sequence TCTGGTGACCCAGACTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072411265_1072411267 -5 Left 1072411265 10:95204069-95204091 CCACTTCAGTCTGGGTCACCAGA 0: 1
1: 0
2: 3
3: 23
4: 201
Right 1072411267 10:95204087-95204109 CCAGAAATTCTTCCTACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072411265 Original CRISPR TCTGGTGACCCAGACTGAAG TGG (reversed) Intronic
901364157 1:8731198-8731220 TCTGGAGGTCCAGACTTAAGAGG + Intronic
901691753 1:10978135-10978157 TCTTGTCACCCAGGCTGGAGTGG - Intronic
901893900 1:12292225-12292247 TCTTGTCACCCAGGCTGGAGTGG - Intronic
902280319 1:15369651-15369673 TCTGGTGACTGTGACTAAAGAGG - Intronic
902923555 1:19681078-19681100 TCTGGGGTCCCAGATTGAAGGGG - Intergenic
904548385 1:31294905-31294927 TCTTGTCACCCAGGCTGGAGTGG - Intronic
905232358 1:36522143-36522165 TCTGGAGACCCAGTCTGAGGGGG - Intergenic
905441122 1:37997134-37997156 TCTGGGAACCCAGACTGCAGGGG + Exonic
905448606 1:38043459-38043481 GCTGGTGACCCAGGCCGAGGTGG + Intergenic
906176199 1:43775266-43775288 TCTTGTCACCCAGGCTGGAGTGG + Intronic
909300613 1:74008753-74008775 TCTTGTCACCCAGGCTAAAGTGG - Intergenic
909759731 1:79271993-79272015 TTTGGTGAGCCTAACTGAAGGGG + Intergenic
910905080 1:92167007-92167029 TCAGTTTACCCAGAGTGAAGTGG + Intergenic
911867092 1:103042504-103042526 TCTGGTGATGCAGACTTTAGGGG - Intronic
912389271 1:109290736-109290758 TCTGGTGATCCCCACTGTAGAGG - Intergenic
912406818 1:109445923-109445945 TCTGGTCACCCAGACTGGAGTGG - Intergenic
912851957 1:113134415-113134437 TCTTGTTGCCCAGGCTGAAGTGG + Intergenic
917646711 1:177036078-177036100 TCTTGTTGCCCAGACTGGAGTGG + Intronic
919739118 1:200971984-200972006 TCTTGGCTCCCAGACTGAAGCGG + Intronic
921841985 1:219838504-219838526 TCTGGTGACCTACACTAAAATGG + Intronic
922959168 1:229630945-229630967 TCTTGTCACCCAGGCTGGAGTGG - Intronic
1063258138 10:4352284-4352306 TCTGGAGACCCAGAGACAAGAGG + Intergenic
1067079560 10:43205462-43205484 CCTGGTGGTCCAGAATGAAGAGG - Intronic
1067792869 10:49301030-49301052 CCTGGAGACCCTTACTGAAGAGG + Intronic
1067847279 10:49734479-49734501 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1070173445 10:73950372-73950394 TCTGGGAAGCCAGACTGAAGAGG + Intergenic
1072411265 10:95204069-95204091 TCTGGTGACCCAGACTGAAGTGG - Intronic
1073587956 10:104728881-104728903 TCTGGTGACCCAGTTATAAGAGG + Intronic
1074001560 10:109378827-109378849 TCGGGGGACCTAGACTGAAGGGG - Intergenic
1074475680 10:113771793-113771815 AGTGGTGACCCAGACTCAAGAGG + Intronic
1075804721 10:125178241-125178263 CCTGGTGTCTCAGACTGAAGAGG + Intergenic
1076505798 10:130971822-130971844 TCTTGTGGCCCAGACTGGAGTGG + Intergenic
1077061103 11:618242-618264 TCTGCTGACCCTGGCTCAAGGGG + Intronic
1079375002 11:19884330-19884352 TTTTCTGACCCAGAGTGAAGCGG - Exonic
1079698241 11:23510776-23510798 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1084981727 11:72832533-72832555 TCTGCTGAACGGGACTGAAGAGG - Intronic
1088249650 11:107851426-107851448 TCTTGTCACCCAGGCTGGAGTGG - Intronic
1088340603 11:108761736-108761758 TCTGGTGACCCAAATGGCAGAGG - Intronic
1090037777 11:123263754-123263776 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1090965937 11:131597679-131597701 TCAGGTGCCCCAGAGTGAGGGGG + Intronic
1095211902 12:39504071-39504093 TTTTGTCACCCAGACTGGAGTGG - Intergenic
1095363512 12:41373534-41373556 GCTGGTGAGCCAGGCAGAAGAGG - Intronic
1095752229 12:45726798-45726820 TCTGGTATCCCAGTCTGCAGTGG - Intergenic
1095772026 12:45970370-45970392 TCTGGTTACACAGAAAGAAGAGG + Intronic
1096359338 12:50969665-50969687 TCTTGTCACCCAGGCTGGAGTGG - Intronic
1097207302 12:57333650-57333672 TCTTGTCACCCAGGCTGCAGTGG - Intronic
1098860857 12:75708432-75708454 TCTTGTCACCCAGGCTGGAGTGG + Intergenic
1102950882 12:117030527-117030549 ACTGGGAACGCAGACTGAAGGGG - Intronic
1103116238 12:118335147-118335169 TCTTGTTGCCCAGGCTGAAGTGG - Intronic
1103221382 12:119248895-119248917 TTTGTTGACCCAAACTGAAGTGG + Intergenic
1105008532 12:132738429-132738451 CCTGGAGACCCAGAGTCAAGAGG + Intronic
1105637004 13:22225299-22225321 TCTAGTGACCCATAAGGAAGTGG - Intergenic
1108543935 13:51472159-51472181 TCTGGTTGCCCAGGCAGAAGTGG + Intergenic
1108584086 13:51852845-51852867 TCTTTTTACCCAGACTGGAGTGG - Intergenic
1109887283 13:68558507-68558529 TATAGTGAACCAGACTGTAGAGG + Intergenic
1109918326 13:69021359-69021381 TCTTGTTGCCCAGGCTGAAGTGG - Intergenic
1110283653 13:73724478-73724500 TCTGGTAACACAGACTCAAGTGG - Intronic
1110363813 13:74659258-74659280 TCTGGGAGCCCAGACAGAAGGGG - Intergenic
1111614508 13:90645508-90645530 TCTTGTGAGCCATATTGAAGGGG - Intergenic
1111641575 13:90977005-90977027 TCTGGTGGCGCAGACTCATGAGG - Intergenic
1114321644 14:21551565-21551587 TCTTGTTGCCCAGACTGGAGTGG - Intergenic
1114615003 14:24063562-24063584 TCTGGTGTCACTGAGTGAAGGGG - Intronic
1115092771 14:29598239-29598261 TCTGTTGCCCCAGGCTGGAGTGG - Intronic
1115108535 14:29790946-29790968 TGAGGTCACCTAGACTGAAGAGG - Intronic
1116225043 14:42139578-42139600 TTTTGTGACCAAAACTGAAGTGG - Intergenic
1116458062 14:45141622-45141644 TCTTGTTACCCAGGCTGGAGTGG + Intronic
1119737009 14:76989163-76989185 TCTTGTTGCCCAGACTGCAGTGG + Intergenic
1119773039 14:77233316-77233338 TCTGGGGAACCAGAAGGAAGAGG + Intronic
1121234786 14:92384298-92384320 TGTGTTGATCAAGACTGAAGGGG + Intronic
1122023664 14:98859265-98859287 CCTGGTGACCCAGGCTGCTGGGG + Intergenic
1122384277 14:101333429-101333451 TCTGGTGACCCAGAAGAAAAAGG + Intergenic
1122560555 14:102611102-102611124 TCTTGTTGCCCAGACTGGAGTGG + Intronic
1124244222 15:28056141-28056163 TCTGGTTACCCAGACTGAACTGG - Intronic
1128797584 15:70476992-70477014 TCTGGTGACTTAGTGTGAAGTGG + Intergenic
1130237560 15:82150823-82150845 TTTGGTTACCCAGACTGATATGG + Intronic
1131571947 15:93546787-93546809 ACTGGTGCCCCATACAGAAGAGG + Intergenic
1131733051 15:95302151-95302173 TCTTGTCACCCGGGCTGAAGTGG - Intergenic
1132001179 15:98181550-98181572 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1133283425 16:4679748-4679770 CCAGGTGACCCAGACTGCGGGGG + Intronic
1134809387 16:17154338-17154360 CCTGGTGACCCTGGATGAAGTGG + Intronic
1135044353 16:19142685-19142707 TCTGGGGACCAAGAATGCAGAGG - Intronic
1135126649 16:19816008-19816030 TCTTGTGAACATGACTGAAGAGG + Intronic
1137449983 16:48563440-48563462 TCTAGTCACCCAGGCTGGAGTGG + Intronic
1140065912 16:71611095-71611117 TCTGGTCACCCAGGCTGAGTCGG + Intergenic
1140735881 16:77897503-77897525 TCTTGTCACCCAGGCTGGAGTGG + Intronic
1141456594 16:84146144-84146166 TCTGGAGACCCAGACTGTCTGGG - Intronic
1143604426 17:7973748-7973770 TCTGGTTGCCCAGGCTGGAGTGG - Intergenic
1147022560 17:37548788-37548810 TCTTGTCACCCAGGCTGGAGTGG - Intronic
1147420086 17:40318238-40318260 CCCGGAGCCCCAGACTGAAGGGG - Intronic
1152920770 17:83065427-83065449 GCTGGTCACCCAGGCTGAAACGG + Intergenic
1154438527 18:14365576-14365598 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1156520409 18:37717553-37717575 TCTGGTTTCTCAGACTGCAGAGG + Intergenic
1157717240 18:49896425-49896447 AGTGGAGACCCAGACTGGAGTGG - Intronic
1157827468 18:50825037-50825059 TCTTGTGGCCCAGGCTGGAGTGG - Intronic
1159436192 18:68420787-68420809 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1162025873 19:7893906-7893928 TCTGATTCCCCAGACTGAAGTGG + Intronic
1163690123 19:18734065-18734087 TCTTGTCACCCAGGCTGCAGTGG - Intronic
1163997747 19:21067896-21067918 TCTTGTTACCCAGGCTGGAGTGG - Intergenic
1164210349 19:23093023-23093045 TCTTGTCACCCAGGCTGGAGTGG + Intronic
1164484534 19:28643472-28643494 TCTGGTGAGCCAGCCTGCAGAGG - Intergenic
1165732618 19:38156044-38156066 TCTCGTTACCCAGGCTGGAGTGG - Intronic
1166698329 19:44867051-44867073 TCTTGTTACCCAGGCTGTAGTGG + Intronic
1166906723 19:46115610-46115632 TCTGGTGACTCAGCCTGAGTGGG + Intergenic
1167157637 19:47749129-47749151 TCTTGTAACCCAGGCTGGAGCGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
1167520212 19:49950227-49950249 GCTGGTGACCCTGAATGCAGGGG + Exonic
1168469321 19:56627931-56627953 TCAGGAGACCCAGGCTGCAGAGG + Intergenic
925406824 2:3611277-3611299 CCCGGTGACCCAGGATGAAGAGG - Intronic
925964337 2:9049900-9049922 TCTGGTGTCCCAAACTCTAGGGG + Intergenic
926648121 2:15312146-15312168 TCTGGTGACGCACACAGAGGAGG - Intronic
927602334 2:24455057-24455079 TCTTGTCACCCAGGCTGGAGTGG + Intergenic
928228045 2:29471774-29471796 TCTTGTTGCCCAGACTGAAGTGG + Intronic
928843798 2:35644318-35644340 TTTGGGGAACCACACTGAAGGGG + Intergenic
935125059 2:100215547-100215569 TCAGGAGACCCAGACTGGTGGGG - Intergenic
935144759 2:100388020-100388042 TCTAGTGGCCCATACTGGAGAGG + Intergenic
938785249 2:134622795-134622817 TCTTGTTGCCCAGACTGGAGTGG + Intronic
939370918 2:141298917-141298939 TCTTGTCACCCAGGCTGGAGTGG - Intronic
941029007 2:160491901-160491923 TCTGGTGACCCAAAGTAAAGTGG + Intronic
941052389 2:160749498-160749520 CCTGGTGGTCAAGACTGAAGGGG + Intergenic
942480627 2:176384499-176384521 CCTGGATACCCAGACTTAAGGGG - Intergenic
943597957 2:189879776-189879798 TCTGGCAACCCAGCCTAAAGAGG - Intronic
944099084 2:196002971-196002993 TCTCGTCACCCAGGCTGGAGTGG - Intronic
944218318 2:197277484-197277506 TCTGGAGACCGTGACTGCAGAGG + Intronic
946785478 2:223239164-223239186 TCTTGTCACCCAGGCTGGAGTGG + Intergenic
948364271 2:237444532-237444554 TGTGGTGACCCAGCCTGAGGAGG - Intergenic
1169450035 20:5702962-5702984 TCTGGTTGCCCAGGCTGGAGTGG + Intergenic
1170001593 20:11620941-11620963 TCAGCGTACCCAGACTGAAGGGG + Intergenic
1170673067 20:18452973-18452995 TCTGTTTTCCCAGCCTGAAGTGG - Intronic
1172806876 20:37618421-37618443 CCTGGGGCCCCAGACTGAACAGG + Intergenic
1173582436 20:44157121-44157143 TCTGGTGTCCGACACTGTAGTGG + Intronic
1174314667 20:49688900-49688922 TCTTGTTACCCAGGCTGAAGTGG - Intronic
1178854459 21:36239066-36239088 TCTTGTCACCCAGGCTGGAGTGG - Intronic
1181645457 22:24229057-24229079 TCTTGTCACCCAGGCTGGAGTGG - Intronic
1183025963 22:35066174-35066196 TCTCCTGAGACAGACTGAAGAGG - Exonic
1184310775 22:43640959-43640981 TCTGGTCACCCAGGCTGGGGAGG - Intronic
1184379565 22:44136583-44136605 GCTGGTGTCCCTGGCTGAAGTGG - Intronic
1184691883 22:46121114-46121136 CCTGGGGACCCAGGCTGAGGAGG + Intergenic
1184699982 22:46164171-46164193 TCTTGTCACCCAGGCTGGAGTGG - Intronic
1184882388 22:47317250-47317272 TCTTGTCACCCAGGCTGGAGTGG + Intergenic
949438107 3:4050711-4050733 TCTGGTTGCCCAGGCTGAAGTGG - Intronic
949619805 3:5797914-5797936 TCTGGAGACCCAGGTGGAAGTGG + Intergenic
950322336 3:12068508-12068530 GCTTGTTACCCAGACTGAAAGGG - Intronic
952754612 3:36855521-36855543 TTTGCTGATACAGACTGAAGAGG + Exonic
953512091 3:43552826-43552848 TCTTGTCACCCAGGCTGGAGTGG + Intronic
953869682 3:46615530-46615552 TCTGGGGGCAGAGACTGAAGAGG - Intronic
954562351 3:51568377-51568399 TCTTGTGACCTAGTCTCAAGTGG - Intronic
954651103 3:52163388-52163410 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
956766748 3:72490781-72490803 TCTGGTGACCAGGACTGACTGGG + Intergenic
958124407 3:89336935-89336957 CCTGTTGACCCAGGCTGAGGTGG + Intronic
959605877 3:108241651-108241673 TCTGGTGACCCAGATGGAATTGG + Intergenic
961015276 3:123463626-123463648 TGTGGTCACCTAGAATGAAGGGG - Intergenic
961380371 3:126492745-126492767 TCTGGAGGCCCAGACTACAGTGG - Intronic
964741091 3:159966902-159966924 TCCGGTGACACAGTCTGCAGTGG - Intergenic
965879674 3:173373456-173373478 TCCAGTGACCAAGAATGAAGTGG + Intergenic
966420421 3:179729244-179729266 TCTGGCTACCCAGACTTAATGGG + Intronic
967294788 3:187954470-187954492 TCTGGTGGCCCAGACTGGGCTGG - Intergenic
967534450 3:190586399-190586421 CTTTGTGACCCAGACAGAAGAGG + Intronic
969961731 4:10951630-10951652 TTTGTTGACCCACACTGATGGGG - Intergenic
973604083 4:52569742-52569764 CCTGGGGACCCAGCCTGAGGTGG + Intergenic
973734447 4:53856716-53856738 TCCAGAGACCCAGACTGATGGGG + Intronic
974362211 4:60896329-60896351 TCTGATGAGCCAGAATTAAGAGG + Intergenic
980011168 4:127596385-127596407 TCTTGTCACCCAGACTGGATGGG + Intergenic
984858495 4:184216407-184216429 ACTGATGCCCCAAACTGAAGGGG - Intronic
987582217 5:19808795-19808817 TCTTGTCACCCAGGCTGGAGTGG - Intronic
992169189 5:74085393-74085415 TCCTGTGAGCCAGACTGACGTGG - Intergenic
995682241 5:114732801-114732823 TCTGGTAATCCAGTATGAAGTGG + Intergenic
997995276 5:138580775-138580797 TCTGTTGAACCAGACTTGAGTGG - Intergenic
998069692 5:139187480-139187502 TCTGTTGCCCCAGGCTGGAGTGG - Intronic
998178762 5:139920430-139920452 TCTGGTAACCCAGACTCATAGGG + Intronic
999630508 5:153566339-153566361 TCTTGTCACCCAGGCTGCAGTGG + Intronic
1001880557 5:175240483-175240505 CCTGGTGTCGCAGACTGAGGAGG - Intergenic
1003504087 6:6725536-6725558 TCTGGTGACCCAGATGGAGGGGG - Intergenic
1004747525 6:18525920-18525942 TATGGTGACACAGACTGAATAGG - Intergenic
1005613957 6:27554987-27555009 TCTAGTTGCCCAGGCTGAAGTGG - Intergenic
1007254038 6:40516186-40516208 CCAGGTCACCCAGCCTGAAGGGG - Intronic
1007459772 6:42009575-42009597 TCTTGTTGCCCAGACTGGAGTGG - Intronic
1007639894 6:43329907-43329929 TCTTGTCACCCAGGCTGGAGTGG + Intronic
1007712949 6:43836265-43836287 CCTGGTGACACCTACTGAAGGGG + Intergenic
1007947633 6:45840298-45840320 TCAGGTGACCCAGCCTGCTGAGG + Intergenic
1009421329 6:63468163-63468185 TCTTGTCACCCAGGCTGGAGTGG + Intergenic
1010208310 6:73342640-73342662 TCTTGTCACCCAGGCTGGAGTGG + Intergenic
1014553321 6:122814221-122814243 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1014574253 6:123050824-123050846 TCTGTTGAAAAAGACTGAAGAGG + Intronic
1014747410 6:125216016-125216038 TCTGCTGACCCCCACTGCAGGGG + Intronic
1016015803 6:139184793-139184815 TCTGGTATCCCAGACTGTTGAGG + Intergenic
1016429154 6:143964667-143964689 TCTGGTGACCTAGGGTGGAGGGG + Intronic
1020027173 7:4907376-4907398 TGAGGTGACCCAGACTTGAGAGG - Exonic
1021483533 7:21144156-21144178 TCAGGTTACCCAGAGTGATGAGG - Intergenic
1023125636 7:36951565-36951587 TCTGATGAATCAGACTGAAGTGG + Intronic
1023320840 7:38996072-38996094 TCTTGTTACCCAGGCTGGAGTGG + Intronic
1025851461 7:65248048-65248070 TCTTGTTGCCCAGGCTGAAGTGG + Intergenic
1026346365 7:69477674-69477696 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1027875786 7:83766638-83766660 TCTTGTCACCCAGGCTGGAGGGG + Intergenic
1028602072 7:92612578-92612600 TCTGATGACACAGAATGAAAGGG - Exonic
1028743581 7:94303385-94303407 TCTAGAGACCCAGGGTGAAGAGG - Intergenic
1028987223 7:97017975-97017997 TCTGGTAAACCAGTCTGCAGCGG - Intergenic
1029683070 7:102125658-102125680 TCTTGTCACCCAGGCTGGAGTGG - Intronic
1030869207 7:114734471-114734493 TATGGTGACTGGGACTGAAGTGG - Intergenic
1031327905 7:120425217-120425239 TCTAGTAACCCAGATGGAAGGGG - Intronic
1031536249 7:122936747-122936769 TCTGGAGACTAAGACTCAAGAGG - Intergenic
1032044011 7:128587699-128587721 TCTGGAGGCCCAGCTTGAAGTGG + Intergenic
1033653871 7:143361192-143361214 TGTGGTGAACCGGACTGAGGAGG + Intronic
1036710873 8:11077788-11077810 TCTGCTGACACAGATTGGAGCGG - Intronic
1039535707 8:38310540-38310562 TCTGGTTGCCCAGGCTGGAGTGG + Intronic
1039870815 8:41543737-41543759 TCTTGTTACCCAGGCTGGAGTGG + Exonic
1042228271 8:66532255-66532277 TCTTGTCACCCAGACTGCAATGG + Intergenic
1042449717 8:68930378-68930400 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1049169067 8:141147193-141147215 GCTGGTGACCCAGAGTGAAGTGG - Intronic
1049758056 8:144319528-144319550 ACTGGTGGCCAAGGCTGAAGAGG + Intronic
1050230177 9:3515714-3515736 TATGCTGACTGAGACTGAAGGGG + Intronic
1051717137 9:19996708-19996730 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1052433179 9:28393416-28393438 GCTGGTAAACCAGACTGAACAGG + Intronic
1055606390 9:77975160-77975182 TTTGGTGACCCAGGATTAAGTGG + Intronic
1056231084 9:84545334-84545356 TCTTGTTGCCCAGGCTGAAGTGG + Intergenic
1060754368 9:126201965-126201987 TCTGGGGACGCAGTCTAAAGTGG + Intergenic
1060974564 9:127756962-127756984 TCTTGTTGCCCAGGCTGAAGTGG + Intronic
1186073328 X:5847704-5847726 TCTGGAGACACATATTGAAGGGG + Intronic
1186437059 X:9551897-9551919 TCTGGTGACCCCCACTGCAGGGG + Intronic
1187506172 X:19880198-19880220 CCTGGTGGCCCACACTGTAGTGG - Intronic
1188356017 X:29192096-29192118 TCTCTTGACTCAGAGTGAAGGGG + Intronic
1188697475 X:33213473-33213495 TGTGGTGACACAGTCTGAACTGG - Intronic
1189389543 X:40564290-40564312 TCTTGTCACCCAGGCTGGAGTGG - Intergenic
1190082793 X:47370011-47370033 TCTTGTCACCCAGGCTGCAGTGG - Intergenic
1190411747 X:50143482-50143504 TCTGGTGACCCTCACTGATCTGG + Intergenic
1190639254 X:52466949-52466971 TCTTGTGTCCCAGCCTGGAGAGG - Intergenic
1193295573 X:79828132-79828154 GATGGTGACCCGGCCTGAAGTGG - Intergenic
1194708854 X:97208727-97208749 TCTGTTGGCCCAGAATTAAGTGG + Intronic
1198206162 X:134467078-134467100 TCTTGTCGCCCAGGCTGAAGTGG + Intronic