ID: 1072412048

View in Genome Browser
Species Human (GRCh38)
Location 10:95211866-95211888
Sequence CTTTCTCTTTAGACGGTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072412043_1072412048 7 Left 1072412043 10:95211836-95211858 CCAGCACGAGAGAATTCAAATGG 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1072412048 10:95211866-95211888 CTTTCTCTTTAGACGGTGGATGG 0: 1
1: 0
2: 1
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072412048 Original CRISPR CTTTCTCTTTAGACGGTGGA TGG Exonic
900893207 1:5464642-5464664 CTTTCCCTGCAGGCGGTGGAAGG - Intergenic
901326749 1:8371217-8371239 CTTTTTCTTTTGGCGGTGGGGGG + Intronic
902979638 1:20113666-20113688 CTTTATCTTAGGACAGTGGAGGG + Exonic
904947298 1:34208763-34208785 CTTGCTCTTTCCACGGTGGATGG + Intronic
914328397 1:146643511-146643533 CGTTCTCTCTACACGGGGGAGGG - Intergenic
915279737 1:154814212-154814234 CTTTCTCCTTAGAATGAGGAGGG + Intronic
915446174 1:155976219-155976241 CTTTCTTTTTATACTGTGGTGGG - Intronic
916062457 1:161109539-161109561 TTTACTCTTGAGACTGTGGAAGG - Intronic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
1065350376 10:24790350-24790372 ATTTCTCTTTGGAAGTTGGAGGG - Intergenic
1069696050 10:70386326-70386348 CTTTCTCTTTAGCTTGTAGATGG - Intergenic
1071423386 10:85524549-85524571 CTTTCTCTTTGAAGAGTGGAAGG - Intergenic
1072412048 10:95211866-95211888 CTTTCTCTTTAGACGGTGGATGG + Exonic
1072624657 10:97103424-97103446 CTTTCTGGTTAGCCGGTGGGAGG - Intronic
1072764411 10:98083992-98084014 CTGTCTCTTCAGGAGGTGGAAGG + Intergenic
1076322080 10:129590632-129590654 GTTTCTCATTAGACTGTGAATGG - Intronic
1082867378 11:57912239-57912261 CTGTGTCCTTACACGGTGGAAGG - Intergenic
1083313758 11:61801526-61801548 TGTTCTCTTTAGACCCTGGAGGG + Exonic
1087274148 11:96143723-96143745 CAATCTCTTTAGAATGTGGAAGG + Intronic
1088011596 11:105008404-105008426 CTTTCTCACAAGACTGTGGAAGG - Intronic
1090980463 11:131716149-131716171 CTATGTCTTTACATGGTGGAAGG + Intronic
1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG + Intronic
1097669377 12:62517601-62517623 CTTTGTCTTCACATGGTGGAGGG - Intronic
1097855081 12:64453017-64453039 CTTTCGTTTTGGACGGTGTAAGG + Intronic
1100882115 12:99030451-99030473 CTTTTTCATTAGACGGGGGTGGG - Intronic
1103367672 12:120394908-120394930 GTTTCTCTTTGGAGGGTGGGAGG - Intergenic
1104167208 12:126244212-126244234 CTGTGTCTTTACATGGTGGAAGG + Intergenic
1105503406 13:20990911-20990933 CTTTCTCTTGGGCCTGTGGAGGG - Intronic
1106208254 13:27619854-27619876 CTTTCTCTTTAGGCTGGAGAGGG - Intronic
1106288132 13:28336019-28336041 TTTTCTTTTTAGATGGTGGAAGG - Intronic
1107275349 13:38671969-38671991 CTTTCTTTATGGAGGGTGGATGG - Intergenic
1107385795 13:39907607-39907629 CTTTCTCTTCAGTCAGTTGATGG - Intergenic
1110086185 13:71383431-71383453 CTTTTTCTATATAAGGTGGATGG + Intergenic
1110175478 13:72550734-72550756 CTTTCTCATAAAAAGGTGGAGGG - Intergenic
1112367204 13:98765346-98765368 CTTTCTTTTTAGACACTTGAAGG - Intergenic
1118367347 14:65107423-65107445 CTTTCTCTTTATCTGGGGGAAGG + Intergenic
1202884460 14_KI270722v1_random:91366-91388 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1126941016 15:53765591-53765613 CTCTCTCTTTAGATGATGGAAGG + Intergenic
1126980917 15:54241716-54241738 TTTTCTCTTTATACAGTGGCCGG + Intronic
1127211018 15:56774769-56774791 CTTCCTGTTCAGAGGGTGGAGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1136315637 16:29453407-29453429 CTTTCTCGGTAGACCCTGGAAGG + Intronic
1136430214 16:30192749-30192771 CTTTCTCGGTAGACCCTGGAAGG + Intergenic
1138025808 16:53521679-53521701 CTTTTTTTTTTGGCGGTGGAGGG - Intergenic
1138233023 16:55353657-55353679 CTTTCTCCTCACATGGTGGATGG - Intergenic
1138390083 16:56663648-56663670 CTTTCTCTTGAGAGGCTGGCTGG - Intronic
1138394037 16:56690859-56690881 CTTTCTCTATGGAGGGTGGAGGG - Intronic
1140005167 16:71067431-71067453 CGTTCTCTCTACACGGGGGAGGG + Intronic
1140644563 16:77015180-77015202 CTTTGTCTTTACATGGTAGAAGG - Intergenic
1140906964 16:79417403-79417425 CATTCTATTTTGAAGGTGGAGGG + Intergenic
1146711295 17:35043970-35043992 CTTTATCTTTAGAAGGTTGGGGG - Intronic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1150346727 17:64410505-64410527 ATTGCTCTTTAGAATGTGGAAGG + Intronic
1153023100 18:649160-649182 CTTTCTCTTTAAACTTTGGCAGG - Intronic
1160192112 18:76722924-76722946 CTTTCCCCTTGGACCGTGGAAGG + Intergenic
1162103502 19:8355071-8355093 CTGTCTTTTAAGACGGTGGCGGG - Intronic
1165819886 19:38667956-38667978 CTTCCTATTTATACGGCGGAAGG + Intronic
1168724238 19:58572065-58572087 CTCTCTCTTTACCAGGTGGATGG + Intronic
1202633613 1_KI270706v1_random:22741-22763 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202652273 1_KI270707v1_random:17318-17340 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1202659868 1_KI270708v1_random:58412-58434 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
925244340 2:2366923-2366945 CATTCACATTAGACAGTGGATGG - Intergenic
926179568 2:10629499-10629521 GTTTGTCTTTAGGCAGTGGAAGG + Intronic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
928419240 2:31124706-31124728 CTTTCTCTTTAAACAGTGCCTGG - Intronic
929023571 2:37577575-37577597 CTATCTCTCTAGAAGGAGGAAGG + Intergenic
929886379 2:45882685-45882707 CTTTCTCTTCCGTTGGTGGATGG - Intronic
931634872 2:64332110-64332132 CTATGTCTTCACACGGTGGAAGG - Intergenic
933993757 2:87652460-87652482 CTGTATCATTACACGGTGGAAGG + Intergenic
936300106 2:111298423-111298445 CTGTATCATTACACGGTGGAAGG - Intergenic
943528409 2:189047840-189047862 CATTCACTTTAGATGGTGAATGG + Intronic
1169262185 20:4147356-4147378 GTTTATCTTTAGAAGGTGAACGG - Intronic
1169452925 20:5727576-5727598 CTTTCTCTTCAGACGGGTAAAGG + Intergenic
1176599878 21:8782337-8782359 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176645827 21:9348598-9348620 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1177183461 21:17768161-17768183 CAATCTCTCTAGAGGGTGGAAGG + Intergenic
1178262420 21:31112143-31112165 CTTTTTTTTTTGGCGGTGGAGGG - Intergenic
1178839054 21:36124019-36124041 CTTTGTCTTCACATGGTGGAAGG - Intergenic
1180327343 22:11441974-11441996 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180367101 22:11950555-11950577 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1184553116 22:45216078-45216100 CTCTCTCTTCAGAGGGAGGAAGG + Intronic
949313220 3:2723544-2723566 CTGTGTCTTCACACGGTGGAAGG + Intronic
949373012 3:3355349-3355371 CTGGCTCTTTACATGGTGGAAGG - Intergenic
951409987 3:22351807-22351829 CCTTCTCTTTTTATGGTGGAGGG - Intronic
951753177 3:26059862-26059884 CTGTGTCTTTACATGGTGGAAGG + Intergenic
954148396 3:48645639-48645661 CTGTCTCTGTAGAGGCTGGAGGG - Exonic
956561599 3:70583097-70583119 CTTTCCCATTACACAGTGGAAGG - Intergenic
959360703 3:105387381-105387403 TTTTCTCTTTAGATGTTTGAAGG + Intronic
962893586 3:139694016-139694038 CTTTCTATTTGGATTGTGGAAGG + Intergenic
963850339 3:150204615-150204637 CTTTCTCTTTACAAGGAGGGAGG + Intergenic
1202741058 3_GL000221v1_random:56465-56487 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
969113737 4:4859242-4859264 CTTTCTCTTTAGTCTGTGGCTGG - Intergenic
969680989 4:8643392-8643414 CTTTCTCTTTACAGGGTTGAGGG - Intergenic
971022142 4:22547568-22547590 CTGTCTCTTCACATGGTGGAAGG - Intergenic
976593674 4:86874369-86874391 CTGTGTCTTTACATGGTGGAAGG - Intergenic
978815778 4:112903164-112903186 GTTTCTCATTGGAAGGTGGAGGG + Intronic
983029165 4:162777674-162777696 ATTTTTATTTAGACAGTGGAAGG + Intergenic
990022358 5:51143190-51143212 CATTGTCTTTACATGGTGGAAGG - Intergenic
990682251 5:58258143-58258165 CTTTCTCTAAAGACCCTGGAAGG - Intergenic
992464247 5:76988108-76988130 CTTTTTCCTTAGACAGTAGAGGG - Intergenic
992642568 5:78780624-78780646 CATTGTATTGAGACGGTGGAGGG + Exonic
994114269 5:96044372-96044394 CTGTGTCTTTATATGGTGGAAGG - Intergenic
994790290 5:104216689-104216711 CTTTCTCATTAGAAAGTGTATGG - Intergenic
995347607 5:111138555-111138577 CTATCTCTATAGACAGTGAATGG - Intergenic
996183190 5:120445831-120445853 CTGTGTCTTTACATGGTGGAAGG - Intergenic
996615536 5:125436689-125436711 CCTTTTCTTGAGACTGTGGAGGG + Intergenic
997056674 5:130452208-130452230 CTGTGGCTTTAGAGGGTGGAAGG - Intergenic
998643206 5:144035352-144035374 CTTTCTCTTTGGCTGGTAGATGG - Intergenic
1004111075 6:12719719-12719741 CTTTCACTTTAGATGGTGATGGG + Intronic
1004418089 6:15443483-15443505 CTAGCACTTTAGAAGGTGGAGGG - Intronic
1009573905 6:65427105-65427127 CTTTTTCTTTAAATGGTGTAGGG + Intronic
1012429763 6:99152231-99152253 CTTCCTCTTTGGCCGCTGGAGGG + Intergenic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1014859244 6:126444086-126444108 CTTTTTGTTTAGACACTGGAAGG + Intergenic
1015788421 6:136941989-136942011 GTTTCTCTTTGGAAGCTGGATGG + Intergenic
1016188363 6:141226738-141226760 CTTTCTCTTTATACGGTTTTTGG + Intergenic
1024110820 7:46144831-46144853 TCTCCTCTTTAGATGGTGGAGGG - Intergenic
1025028764 7:55538956-55538978 CTTTCTCTGTAGAGGGTCTAGGG + Intronic
1026624998 7:71984177-71984199 CTTTCTCTTTGCATAGTGGAGGG + Intronic
1030641937 7:112015847-112015869 CTTTGTCTTCACATGGTGGAAGG + Intronic
1031200033 7:118670628-118670650 TTTTTTCTTGAGACGGAGGACGG + Intergenic
1033158658 7:138978367-138978389 CTTTGTTTTTATACTGTGGATGG + Intronic
1034796058 7:154014753-154014775 CTTTGTTTTTAGAACGTGGAGGG - Intronic
1035757760 8:2046828-2046850 CTTTCTATGTAGACAGTAGAGGG + Intronic
1037586914 8:20283344-20283366 CTATGTCTTCAGATGGTGGAAGG - Intronic
1038691611 8:29768696-29768718 CTTTCTCTTTCTATTGTGGAAGG + Intergenic
1044338483 8:91018507-91018529 CTTTCTCTTTTCACAGTAGACGG - Exonic
1044742731 8:95344158-95344180 CTGTTTCTTTAGAGGTTGGAAGG - Intergenic
1046130823 8:109966278-109966300 CTTTCCCTTCAGATTGTGGAAGG + Exonic
1046204468 8:110974688-110974710 CTGTTTCTTTTGACTGTGGAGGG + Intergenic
1046294837 8:112203990-112204012 CTATCTCTTTAGACAAAGGAGGG - Intergenic
1047357773 8:124139652-124139674 CTCTCTCCTTAGCTGGTGGATGG + Intergenic
1048427589 8:134337030-134337052 CCACCTCTTCAGACGGTGGACGG + Intergenic
1048653293 8:136505338-136505360 CTTTCTCCTTAGACGGTAGAGGG + Intergenic
1054877817 9:70114832-70114854 CTTTCTTTTTTGATGGAGGAAGG - Intronic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1059577973 9:115512240-115512262 CTGTGTCTTTACATGGTGGAAGG + Intergenic
1060101889 9:120847933-120847955 CTCTCTCTTTTGAGGGTGTAAGG - Intergenic
1061529825 9:131201921-131201943 CTTTCTCAGAAGACTGTGGAAGG - Intronic
1061766774 9:132886503-132886525 CTTTTGCTTTAGGCGGTGGTTGG + Intronic
1061799599 9:133106662-133106684 CGTCTTCTTCAGACGGTGGATGG + Exonic
1203709697 Un_KI270742v1:86395-86417 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1186556026 X:10559717-10559739 CTTTCTCTGTTGATGGTGGCAGG - Intronic
1186985564 X:15009936-15009958 CTGTGTCTTCACACGGTGGAAGG - Intergenic
1188604016 X:32006008-32006030 CTTTAGCTTTAGACGGTGGGTGG + Intronic
1188845378 X:35065717-35065739 CTTGCCCTTTTCACGGTGGAAGG - Intergenic
1189047497 X:37609194-37609216 ATTTCTTTTTAGCAGGTGGAAGG - Intronic
1190501904 X:51087585-51087607 ATTCCTCTTTAGATGGTGGATGG + Intergenic
1193207836 X:78769787-78769809 CTATCTCTGTAGACAGTTGAAGG + Intergenic
1196059716 X:111394886-111394908 CCTTTTCTTTACACTGTGGATGG - Intronic
1197037711 X:121897028-121897050 CTGTGTCTTTACATGGTGGAAGG - Intergenic
1197328864 X:125128612-125128634 CTTTCTATTTAGCCGGTGAATGG - Intergenic