ID: 1072415860

View in Genome Browser
Species Human (GRCh38)
Location 10:95246236-95246258
Sequence CCAGGGAAGAAGCGGGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072415853_1072415860 12 Left 1072415853 10:95246201-95246223 CCATGAGCATCACAGGAGGTGCT 0: 1
1: 0
2: 1
3: 18
4: 174
Right 1072415860 10:95246236-95246258 CCAGGGAAGAAGCGGGTGTGAGG No data
1072415852_1072415860 13 Left 1072415852 10:95246200-95246222 CCCATGAGCATCACAGGAGGTGC 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1072415860 10:95246236-95246258 CCAGGGAAGAAGCGGGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072415860 Original CRISPR CCAGGGAAGAAGCGGGTGTG AGG Intronic
No off target data available for this crispr