ID: 1072417786

View in Genome Browser
Species Human (GRCh38)
Location 10:95263301-95263323
Sequence CCAGATCAGAACCTATTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072417772_1072417786 22 Left 1072417772 10:95263256-95263278 CCACCTGCAGCCCTACCTCTCCC 0: 1
1: 0
2: 3
3: 83
4: 788
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417776_1072417786 7 Left 1072417776 10:95263271-95263293 CCTCTCCCCCAGTTAAGCCTGCC 0: 1
1: 0
2: 0
3: 15
4: 286
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417773_1072417786 19 Left 1072417773 10:95263259-95263281 CCTGCAGCCCTACCTCTCCCCCA 0: 1
1: 0
2: 4
3: 77
4: 677
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417771_1072417786 27 Left 1072417771 10:95263251-95263273 CCTTTCCACCTGCAGCCCTACCT 0: 1
1: 0
2: 3
3: 57
4: 421
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417775_1072417786 11 Left 1072417775 10:95263267-95263289 CCTACCTCTCCCCCAGTTAAGCC 0: 1
1: 0
2: 0
3: 20
4: 211
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417774_1072417786 12 Left 1072417774 10:95263266-95263288 CCCTACCTCTCCCCCAGTTAAGC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417780_1072417786 -1 Left 1072417780 10:95263279-95263301 CCAGTTAAGCCTGCCTCTGTCCC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417778_1072417786 1 Left 1072417778 10:95263277-95263299 CCCCAGTTAAGCCTGCCTCTGTC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417769_1072417786 29 Left 1072417769 10:95263249-95263271 CCCCTTTCCACCTGCAGCCCTAC 0: 1
1: 1
2: 2
3: 39
4: 356
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417781_1072417786 -10 Left 1072417781 10:95263288-95263310 CCTGCCTCTGTCCCCAGATCAGA 0: 1
1: 0
2: 5
3: 50
4: 430
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417779_1072417786 0 Left 1072417779 10:95263278-95263300 CCCAGTTAAGCCTGCCTCTGTCC 0: 1
1: 0
2: 2
3: 12
4: 151
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417777_1072417786 2 Left 1072417777 10:95263276-95263298 CCCCCAGTTAAGCCTGCCTCTGT 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data
1072417770_1072417786 28 Left 1072417770 10:95263250-95263272 CCCTTTCCACCTGCAGCCCTACC 0: 1
1: 0
2: 3
3: 51
4: 446
Right 1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072417786 Original CRISPR CCAGATCAGAACCTATTCCT AGG Intronic
No off target data available for this crispr