ID: 1072419659

View in Genome Browser
Species Human (GRCh38)
Location 10:95279426-95279448
Sequence CTGTATTAGAAGAGTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072419659_1072419663 11 Left 1072419659 10:95279426-95279448 CCTTCTTGACTCTTCTAATACAG No data
Right 1072419663 10:95279460-95279482 AATAATTGAGCAGAGCTTACTGG No data
1072419659_1072419664 12 Left 1072419659 10:95279426-95279448 CCTTCTTGACTCTTCTAATACAG No data
Right 1072419664 10:95279461-95279483 ATAATTGAGCAGAGCTTACTGGG No data
1072419659_1072419665 17 Left 1072419659 10:95279426-95279448 CCTTCTTGACTCTTCTAATACAG No data
Right 1072419665 10:95279466-95279488 TGAGCAGAGCTTACTGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072419659 Original CRISPR CTGTATTAGAAGAGTCAAGA AGG (reversed) Intronic
No off target data available for this crispr