ID: 1072419659

View in Genome Browser
Species Human (GRCh38)
Location 10:95279426-95279448
Sequence CTGTATTAGAAGAGTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072419659_1072419663 11 Left 1072419659 10:95279426-95279448 CCTTCTTGACTCTTCTAATACAG 0: 1
1: 0
2: 0
3: 21
4: 209
Right 1072419663 10:95279460-95279482 AATAATTGAGCAGAGCTTACTGG No data
1072419659_1072419665 17 Left 1072419659 10:95279426-95279448 CCTTCTTGACTCTTCTAATACAG 0: 1
1: 0
2: 0
3: 21
4: 209
Right 1072419665 10:95279466-95279488 TGAGCAGAGCTTACTGGGTGAGG No data
1072419659_1072419664 12 Left 1072419659 10:95279426-95279448 CCTTCTTGACTCTTCTAATACAG 0: 1
1: 0
2: 0
3: 21
4: 209
Right 1072419664 10:95279461-95279483 ATAATTGAGCAGAGCTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072419659 Original CRISPR CTGTATTAGAAGAGTCAAGA AGG (reversed) Intronic
900080767 1:855782-855804 ATGTATGAGATGAGTCACGAGGG + Intergenic
906755437 1:48309968-48309990 CTTGATTAGAAAAGACAAGAAGG - Intronic
906955905 1:50373413-50373435 CTGGATTAGAAGCTTCAGGAGGG - Intergenic
908663680 1:66465726-66465748 CAATATAAGAAGAATCAAGATGG + Intergenic
909540962 1:76791002-76791024 GTGGATTTGAAGAGGCAAGAGGG + Intergenic
911399131 1:97352866-97352888 CTGTATTATATGAGACAATAAGG + Intronic
912046405 1:105464622-105464644 CTGTCTTAGAAGAGTTGAGGAGG + Intergenic
913594741 1:120363760-120363782 CTGTTTTAGAAAAGTCAATCAGG + Intergenic
913706092 1:121424297-121424319 CTGAATTAGAACAGTCTAGAAGG + Intergenic
914092526 1:144515226-144515248 CTGTTTTAGAAAAGTCAATCAGG - Intergenic
914306006 1:146418649-146418671 CTGTTTTAGAAAAGTCAATCAGG + Intergenic
914596046 1:149154157-149154179 CTGTTTTAGAAAAGTCAATCAGG - Intergenic
915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG + Intronic
917675544 1:177315871-177315893 CTGTATTAGTCCAGTCAAAAAGG - Intergenic
918200987 1:182266678-182266700 CCGTATAAGAAGAGACATGAGGG + Intergenic
918479929 1:184967798-184967820 TTGTATTAGAAGCCACAAGAGGG + Intronic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
918830527 1:189391373-189391395 ATGTATTGGAAGAATCAATATGG + Intergenic
919418435 1:197340835-197340857 CTTTATTAGCAGAGTGAAAATGG - Intronic
919581903 1:199386974-199386996 CTATATTAGAAGCCTCAAGAAGG - Intergenic
921621413 1:217330050-217330072 CTGTACTAGGAGAGTATAGAGGG - Intergenic
924381676 1:243471166-243471188 CTGGATTAGCAGAGTCGGGATGG + Intronic
1063651291 10:7939953-7939975 CTATATTACAAGAGTCTAAAAGG + Intronic
1063945270 10:11169937-11169959 GTGTCACAGAAGAGTCAAGAAGG + Intronic
1064016522 10:11776862-11776884 AAGTATTACAAGAATCAAGAAGG - Intergenic
1064095990 10:12424869-12424891 CTCTATTAGATGATGCAAGAGGG - Intronic
1065614139 10:27503136-27503158 CTTTATTAGAAGTCTCATGAAGG - Intergenic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1068963433 10:62887907-62887929 CTGTAAAAGATTAGTCAAGAAGG + Intronic
1069410782 10:68151245-68151267 CTGTATCAGATCATTCAAGATGG + Intronic
1071735250 10:88291640-88291662 CTGGATTAGAAGATTACAGAAGG + Intronic
1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG + Intronic
1072419659 10:95279426-95279448 CTGTATTAGAAGAGTCAAGAAGG - Intronic
1074597936 10:114884610-114884632 CTGTATTAAATGAGCCAATATGG + Intronic
1075273549 10:121074157-121074179 CTGTTTTGGAAAAGGCAAGAAGG - Intergenic
1075296215 10:121278046-121278068 TTTTATTAGAAGGCTCAAGAGGG + Intergenic
1075623399 10:123944527-123944549 CTGTCTAGGGAGAGTCAAGAGGG - Intergenic
1075924235 10:126237131-126237153 CTGAATTAGATGTGTCATGAGGG - Intronic
1079269827 11:18973801-18973823 TTGTATTAGCAGAGTCAATGAGG + Intergenic
1079765925 11:24392910-24392932 TTGTATTAAAAGTTTCAAGATGG - Intergenic
1080307928 11:30856763-30856785 CAGTATTAAATGAGTAAAGAAGG + Intronic
1080598935 11:33803170-33803192 CTGTTTTAGAAGTCACAAGACGG - Intergenic
1080707693 11:34713455-34713477 CTCTATTAGAACAGTGAGGAGGG + Intergenic
1081350072 11:42041172-42041194 CTCCATTTGAAGAGTTAAGATGG + Intergenic
1087490156 11:98815196-98815218 CTGCATGACAAGAGTCATGAAGG + Intergenic
1087662847 11:101008040-101008062 CTGGATTGGAAGATTCAAGATGG - Intergenic
1088657500 11:112014574-112014596 CTGTATTGGAAGACTGAAGATGG - Intronic
1089034608 11:115373929-115373951 TTGAATTGGAAGAGTCAAAATGG + Intronic
1089111959 11:116064284-116064306 CTGTTTTGGGAGAGTAAAGAGGG - Intergenic
1090597028 11:128330705-128330727 TTGAATTAGAAAAGCCAAGATGG + Intergenic
1091523824 12:1276054-1276076 CTTTTTCAGAAGAGTAAAGAAGG + Intronic
1093154984 12:15672704-15672726 TTGTATTACAAGAGTCATAACGG - Intronic
1093356727 12:18176233-18176255 CAGTCTTAGGAGAGTCAAGGGGG - Intronic
1093594130 12:20941218-20941240 CAGTCTGAGAAGAGTCAGGAGGG + Intergenic
1096923356 12:55114310-55114332 ATGTATTAAAATAGTCATGATGG - Intergenic
1097734335 12:63165461-63165483 CTGTACTATAAGACTGAAGAAGG - Intergenic
1098856823 12:75662466-75662488 CTGTATTAGCAGTGTGAAAATGG - Intergenic
1099513134 12:83562899-83562921 ATGCATTAGAAGAGACTAGAAGG - Intergenic
1100330709 12:93579257-93579279 CTGTGTTAGATAAGTCAAGAGGG - Intronic
1100422554 12:94450744-94450766 ATGGATTGGAAGACTCAAGATGG + Intronic
1103131613 12:118473724-118473746 TGGTAGTAGGAGAGTCAAGATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107195250 13:37643494-37643516 CAGTATTAGATGGGTCATGAAGG + Intronic
1108917851 13:55637753-55637775 ATGTGTTATGAGAGTCAAGAAGG + Intergenic
1109958833 13:69604656-69604678 CTTTATTAGAAGGGTTCAGAAGG - Intergenic
1110504229 13:76266484-76266506 AGGTATTAGCAGAGGCAAGAAGG - Intergenic
1111128058 13:83937399-83937421 CTATCTTAGAAAAGTCAAAAGGG - Intergenic
1112033840 13:95479949-95479971 CTTTATTAGCAGTGTGAAGATGG - Intronic
1115772538 14:36680905-36680927 ATGTATTTGGAGACTCAAGATGG - Intronic
1117728858 14:58701292-58701314 ATGTACAAAAAGAGTCAAGACGG - Intergenic
1119050543 14:71364084-71364106 CTGTATTAGAAGTATTAAAATGG + Intronic
1120005470 14:79352008-79352030 CTGAGTTAGAAGTGTCAAAATGG + Intronic
1120615979 14:86705440-86705462 CTGTATTAGACCATTCAAGAGGG - Intergenic
1121949055 14:98153511-98153533 TTGTATTAGTAGATTCATGATGG + Intergenic
1125321698 15:38495537-38495559 TTGGATTAGTATAGTCAAGATGG + Intronic
1126180206 15:45777766-45777788 CTTTATTAAATGAGTAAAGAGGG + Intergenic
1126515800 15:49536447-49536469 ATGTATCAGAAGAATCAATATGG + Intronic
1129568585 15:76653249-76653271 ATGGATTGGAAGAGTCAATAGGG + Intronic
1131082946 15:89552294-89552316 CTGTTTTAACAGACTCAAGAGGG - Intergenic
1136291289 16:29273070-29273092 CTGCATTAGAATCGCCAAGAGGG + Intergenic
1140339939 16:74147785-74147807 CTGGATCAGAAGACTCAATATGG - Intergenic
1140449932 16:75062822-75062844 CTGCATTAGAAAAGGCAAGGGGG - Intronic
1145048232 17:19636378-19636400 CAGTGTTATAAGGGTCAAGAGGG + Intergenic
1146165742 17:30587043-30587065 CTGTCTTAGAGGCTTCAAGATGG + Intergenic
1149223741 17:54444392-54444414 CTGTATTCTAAGAGTGAGGATGG - Intergenic
1149262330 17:54893540-54893562 TGGTATTAGAAGAGAAAAGAAGG + Intergenic
1150006840 17:61475252-61475274 CTTTATTCCAAGGGTCAAGAGGG + Intronic
1151142513 17:72007547-72007569 CTGTAATATAGGAGTCAAAAAGG + Intergenic
1152095711 17:78270464-78270486 CTGTCTTCTAAGAGGCAAGATGG + Intergenic
1155477840 18:26252662-26252684 GTGTACTATAACAGTCAAGAGGG - Intronic
1156880259 18:42068987-42069009 CTGTATTTGAAGAGTTATAACGG - Intronic
1158254603 18:55531809-55531831 CTGTATTAGTTGTCTCAAGAGGG - Intronic
1159429893 18:68337789-68337811 CTGTATTAGAATTCTCTAGAGGG + Intergenic
1164581068 19:29435464-29435486 CTGGAGTACAACAGTCAAGAAGG + Intergenic
925537423 2:4932600-4932622 CTTTTTTAGAAGAGTAAAGAAGG - Intergenic
927605790 2:24485047-24485069 CTTTATTAGCAGAGTGAAAACGG + Intergenic
928289702 2:30026514-30026536 ATGTAATAAAAGAGTCCAGAGGG + Intergenic
930926664 2:56826563-56826585 CTGAATTAGAAGAATAAAGATGG + Intergenic
931161051 2:59691114-59691136 GTGTATGAGAACAGCCAAGATGG + Intergenic
931285869 2:60831054-60831076 CTGTATTAGTAAAGTTGAGAGGG - Intergenic
931894584 2:66714751-66714773 CTGTAGCTGAGGAGTCAAGATGG + Intergenic
934540107 2:95166684-95166706 CTGCAAAAGAAGAGTCAAAAGGG + Intronic
935887876 2:107643326-107643348 CTTTATTAGAAGTGTGAAAATGG + Intergenic
936776155 2:115975821-115975843 ATCTATTACAATAGTCAAGAAGG + Intergenic
937702090 2:124874550-124874572 ATATTTTAGAAGAGTAAAGAAGG - Intronic
938235517 2:129703192-129703214 CTGTATTAGCAGTGTGAAAATGG - Intergenic
938704351 2:133908647-133908669 CTGTATGACAAGAGTATAGAGGG + Intergenic
939103595 2:137924430-137924452 CTATATTGGAAGAGTCAAAAAGG - Intergenic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939880415 2:147624535-147624557 CTCTCTTAGAAGAGTCAATAAGG - Intergenic
941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG + Intergenic
945127076 2:206524494-206524516 CTTTATTAGCAGAGTGAAAATGG - Intronic
945720272 2:213410380-213410402 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
947349047 2:229223565-229223587 CTGTATTCTAACAGTCAGGATGG + Intronic
947752239 2:232539179-232539201 CTGAAGTAGAAGAATCAAGGTGG + Intergenic
948250566 2:236525311-236525333 CTGGATTGGGAGAGCCAAGAGGG - Intergenic
948766283 2:240222712-240222734 CTGTATTAGAAAAGAAAAAAAGG - Intergenic
1169979848 20:11372118-11372140 CTTTATTAGAAAAGTGAATATGG + Intergenic
1176343287 21:5717691-5717713 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1176501540 21:7606765-7606787 CCTTATTAGAAGAGGCAGGAAGG + Intergenic
1176537608 21:8115760-8115782 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1177252516 21:18612827-18612849 CTATGTGAGCAGAGTCAAGATGG - Intergenic
1177346699 21:19882601-19882623 CTCAATTTGAAGAGTAAAGATGG - Intergenic
1177544157 21:22534976-22534998 ATCTATTGGAAGAGCCAAGATGG + Intergenic
1179527808 21:41995084-41995106 CTTTATTAGAAGTGTGAAAATGG + Intronic
1183134693 22:35875361-35875383 CTCTAATAGAAAAGTAAAGAGGG - Intronic
1185086303 22:48742771-48742793 GTGTATTAGAAGAGGAGAGATGG + Intronic
1203242554 22_KI270733v1_random:32115-32137 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
949259936 3:2093818-2093840 CTTTATTAGAAGTGTGAAAATGG + Intergenic
949920727 3:8998195-8998217 CTGTTTTAAAAGCATCAAGAAGG - Intronic
951090051 3:18561889-18561911 CTGTAATAGTTGAGTCAAGAAGG - Intergenic
953008914 3:39005263-39005285 CTGTTTTAGAAGAAACAACAAGG - Intergenic
957996210 3:87692882-87692904 CTGTATAGCAGGAGTCAAGATGG - Intergenic
958040044 3:88216381-88216403 ATGTTTCAGCAGAGTCAAGATGG - Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
960321961 3:116247842-116247864 CTGTCTCAGATGAGTCAATATGG - Intronic
960919297 3:122730318-122730340 CTGTAATAGAAGAAGCCAGAAGG - Exonic
961052016 3:123755061-123755083 CTGTATGAGCAGAGTCCTGAGGG - Intronic
961961012 3:130855109-130855131 CAGGATTAGAAGGGTGAAGATGG - Intronic
962700621 3:137996150-137996172 CTGTATTATCTGATTCAAGAAGG + Intergenic
962799647 3:138879287-138879309 TTGGAGTATAAGAGTCAAGAAGG - Intergenic
963541798 3:146600377-146600399 CTGGATTGGAAGAGGCAGGAAGG + Exonic
964818671 3:160745562-160745584 CTGTGATTGAAGAGTCAGGAAGG + Intergenic
965382484 3:168007069-168007091 CAGTATTAGAAGGGATAAGATGG + Intergenic
965404847 3:168255801-168255823 CTCCATTAGGGGAGTCAAGAGGG - Intergenic
965911840 3:173787641-173787663 CTGGATTACAAGAATCAATATGG - Intronic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
970386907 4:15565416-15565438 CTGTATTAGAACAGTGAGGGAGG - Intronic
970548015 4:17149208-17149230 CTGTATCAGTAGAGTGAAAATGG + Intergenic
971776689 4:30975382-30975404 CTGTATTATATTAGTCATGAAGG - Intronic
972012273 4:34199712-34199734 ATGTATTAGACAAATCAAGATGG - Intergenic
972453215 4:39225454-39225476 CTGTATTAGATGAGTAAAAATGG + Intronic
974689580 4:65279110-65279132 ATGTATTAGAAATGTGAAGAGGG + Intergenic
974963196 4:68729708-68729730 CTTTATTAGCAGTGTCAAAATGG - Intergenic
975205632 4:71641802-71641824 CAGTCTGAGGAGAGTCAAGAGGG - Intergenic
975249583 4:72162990-72163012 ATGGATTAGAAGATTCAATATGG - Intergenic
975793350 4:77980212-77980234 ATGGATTAGAAGAGTTAATATGG + Intergenic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977257286 4:94755278-94755300 CTGTATTATGAGTTTCAAGAAGG + Intergenic
977698871 4:99998799-99998821 TTGTATTGGAAAAGTCTAGATGG + Intergenic
979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG + Intergenic
980316786 4:131211077-131211099 CTTCATTAGAAGATTCCAGAAGG + Intergenic
982428836 4:155298541-155298563 CTCTACTAGAACAGTGAAGATGG - Intergenic
985212968 4:187614979-187615001 ATGGATTAGAAGACTCAAGATGG + Intergenic
986049045 5:4070040-4070062 CTGGCTTTGAAGAGTCAAGCTGG - Intergenic
986962613 5:13233966-13233988 CTGGATTAGAAGACACAATATGG - Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
989110454 5:37902145-37902167 CTGTATTAGAGGATCAAAGAGGG - Intergenic
989971929 5:50535460-50535482 CTGAATTAGAACAGTCTAGAAGG - Intergenic
991306063 5:65177450-65177472 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
992816696 5:80447843-80447865 CTGAATTTGAAGAATCAAAATGG + Intronic
994038642 5:95231807-95231829 CAGTATTATAAATGTCAAGAAGG + Intronic
994473851 5:100242350-100242372 CTGAATTAGCACAGTAAAGATGG + Intergenic
994567849 5:101475064-101475086 TTGTATTAGAAGATTCATTATGG + Intergenic
994805437 5:104441411-104441433 CTGATTTAGAAGAATCATGAAGG - Intergenic
996400822 5:123060315-123060337 CTGTATTCTGAGAGTCAAGTGGG - Intergenic
999684716 5:154091891-154091913 ATTTATTACAGGAGTCAAGAAGG - Intronic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001842456 5:174890302-174890324 CTGTACCAGAATAGTCAAGGAGG + Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005169805 6:22969728-22969750 ATGTATTAGATGACTCAAAAGGG + Intergenic
1005857727 6:29875620-29875642 ATGTATCAGAAGACTCAGGATGG + Intergenic
1007535355 6:42582354-42582376 CTGTATTATTACAGTCTAGAAGG - Intronic
1014171700 6:118286108-118286130 CTGTAAGACAAGAGTCAACAGGG + Intronic
1016585697 6:145682037-145682059 CTTTATTAGCAGAGTGAAAACGG - Intronic
1018794115 6:167172518-167172540 CTGGATTAGAAGAGAAAAGCTGG - Intronic
1020939977 7:14520430-14520452 CTGTAGTAGAAGAGAAAAAAAGG - Intronic
1021390602 7:20088127-20088149 ATAAATTAGAATAGTCAAGATGG - Intergenic
1026671586 7:72395599-72395621 CTGCATTAGAAGAATCACAAAGG + Intronic
1027181086 7:75939906-75939928 CTATATAATAAGAGTAAAGAGGG - Intronic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1030552507 7:110980788-110980810 CTGTATAACAAGAGTTAATATGG - Intronic
1033389430 7:140912453-140912475 CTGTCTTAGAAGAGGTAAGAGGG - Intronic
1033690200 7:143728785-143728807 CTCTAACCGAAGAGTCAAGATGG - Intronic
1033984063 7:147200983-147201005 ATATTTTAGAAGAGTGAAGATGG + Intronic
1034289859 7:149921263-149921285 CTGTGGGAGAAGAGTCCAGAAGG - Intergenic
1035095662 7:156352735-156352757 CTGTACTAGATGAGGCAGGATGG - Intergenic
1035524500 8:301680-301702 ATGTATGAGATGAGTCACGAGGG - Intergenic
1036229691 8:6989421-6989443 CTGTATTGGACGTGTCAAGTAGG + Intergenic
1036232142 8:7008524-7008546 CTGTATTGGACGTGTCAAGTAGG + Intronic
1036736426 8:11321738-11321760 CTGAATTAGAAAAATCAACATGG + Intronic
1036780847 8:11646097-11646119 CTGTCTTAAAACAGTCAAGGAGG + Intergenic
1037247976 8:16858524-16858546 ATGCATTAGAAAAGTCAAGAGGG - Intergenic
1041356018 8:57001155-57001177 CTTTATTAGAAGAGTAACAATGG - Intergenic
1041515449 8:58694667-58694689 CAGTCTGAGAAGAGTCAGGAGGG - Intergenic
1041653235 8:60322044-60322066 CTGTATTTGAGGAGTCAGGGTGG + Intergenic
1043055911 8:75438271-75438293 CTGTATAAGAAGAGACAAATAGG - Intronic
1044162992 8:88944253-88944275 CTGTATCAGAAGAGGCCTGAAGG - Intergenic
1045934336 8:107661735-107661757 CTGAATTTGAAGGGTCATGATGG - Intergenic
1051596338 9:18827658-18827680 CTGTGTTAGCAGAGACAATAAGG - Intronic
1052214916 9:25954255-25954277 CTGACTTAGTAGAGTCAATAGGG + Intergenic
1054730879 9:68701983-68702005 CTGAATTGGAAGGTTCAAGAAGG - Intergenic
1055680568 9:78710937-78710959 CTGTATCAGTAGAGTTAAGATGG + Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1059372279 9:113851802-113851824 CTTTAACAGAAGATTCAAGATGG - Intergenic
1059881889 9:118700139-118700161 CTGTGTTGGAAGAGTAGAGATGG - Intergenic
1059901095 9:118926923-118926945 CTGTTACAGAAGATTCAAGATGG + Intergenic
1203458880 Un_GL000220v1:15198-15220 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1186751769 X:12628820-12628842 CTTTATTAGGAGTGTGAAGACGG - Intronic
1188166404 X:26869914-26869936 CTTTATTAGAGCAGTGAAGAGGG - Intergenic
1189740264 X:44110678-44110700 CTGTGTTTGAAGAGTGTAGAAGG - Intergenic
1190451324 X:50584119-50584141 CTGAATCAGAAGATTCATGATGG + Intergenic
1191125374 X:56948221-56948243 CTGTATGAGAACAGTCAGGTTGG - Intergenic
1193011888 X:76685841-76685863 CTGTAGTAGATGAGTGAGGAAGG + Intergenic
1193633583 X:83920512-83920534 ATGGATTAGAAGAATCAATATGG - Intergenic
1196067452 X:111480478-111480500 ATGTATTAGAAGACTTAATATGG - Intergenic
1196483781 X:116180920-116180942 CTTTATTAGCAGAGTGAAAATGG + Intergenic
1198208791 X:134496638-134496660 ATTTATTGGAAGAGTCATGAGGG + Intronic
1199507835 X:148585889-148585911 TTGCATTAGAATGGTCAAGATGG + Intronic
1200861114 Y:7993872-7993894 CTGTATGGGAACAGTCAAGTTGG + Intergenic
1202051654 Y:20787880-20787902 ATGGATTAGAAGAATCAATATGG - Intergenic