ID: 1072419947

View in Genome Browser
Species Human (GRCh38)
Location 10:95281810-95281832
Sequence AGTTATTTAGATATCTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 403}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072419947_1072419950 2 Left 1072419947 10:95281810-95281832 CCAAACAAGATATCTAAATAACT 0: 1
1: 0
2: 1
3: 32
4: 403
Right 1072419950 10:95281835-95281857 ACGTGGGTCCTATTTTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072419947 Original CRISPR AGTTATTTAGATATCTTGTT TGG (reversed) Intronic
900924629 1:5696651-5696673 AGTTATTTACATAAATTATTTGG - Intergenic
902064776 1:13675800-13675822 AGTCATTTGTATATCTTCTTTGG + Intergenic
903698342 1:25226551-25226573 AGTTACTTAGATATTATTTTAGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
905782270 1:40722169-40722191 ATTTATTTATATATATTTTTTGG - Intronic
906889062 1:49687257-49687279 ATCTATTTACATATATTGTTTGG - Intronic
908833130 1:68201241-68201263 AGATATTAAGAAATCTTTTTAGG - Intronic
909812634 1:79950327-79950349 AGATATTTTGATAGCTTCTTTGG - Intergenic
910314024 1:85861260-85861282 AGTCATTTGTATATCTTCTTTGG + Intronic
910690253 1:89958425-89958447 GGTCATTTATATATCTTCTTTGG - Intergenic
910990116 1:93047199-93047221 ATTTATTTATATATATTTTTTGG - Intergenic
911992595 1:104720658-104720680 GGTCATTTATATATCTTGCTTGG - Intergenic
912023037 1:105130708-105130730 AATTATTTGGATATCCTCTTTGG - Intergenic
912158353 1:106950082-106950104 AGTTATTTTGTTTTCTGGTTTGG - Intergenic
912311326 1:108624103-108624125 AGTTGTTTAGATTTGTTTTTTGG - Intronic
912610864 1:111042630-111042652 ATTTATTTAGGTATCTAGTAAGG + Intergenic
912694745 1:111832795-111832817 AGTTATAAAGACATCTTGATGGG - Intronic
912785350 1:112597862-112597884 AGTTATTTAGTTATTTGGCTTGG - Intronic
912951617 1:114124301-114124323 ATTCAGTTAGAAATCTTGTTGGG + Intronic
914440529 1:147701518-147701540 AGTCATTCATATATCTTCTTTGG + Intergenic
915775785 1:158484485-158484507 GGATATTTATAAATCTTGTTGGG + Intergenic
916030370 1:160871753-160871775 AGGCATTTGTATATCTTGTTTGG + Intergenic
916068072 1:161152413-161152435 ATAGATTTAAATATCTTGTTTGG - Intergenic
916775413 1:167957924-167957946 AGTCATTTACATACCTTCTTTGG + Intronic
917091162 1:171354749-171354771 ACTTATAAACATATCTTGTTTGG + Intergenic
917882722 1:179354512-179354534 AGTTATTTAGAAATATCCTTTGG + Exonic
918002701 1:180512662-180512684 AGTTATTAAGAAATTATGTTAGG - Intergenic
918594422 1:186276568-186276590 AGTCATTTCTATATCTTCTTTGG - Intergenic
918675188 1:187275702-187275724 AGTTATTTCGTTGTTTTGTTAGG + Intergenic
918806746 1:189057130-189057152 AGTTATTTGTATATCTTCTTTGG - Intergenic
919501624 1:198344708-198344730 AGTTATTTTTATATGTTGTCAGG - Intergenic
920808690 1:209260573-209260595 ACTTATTTAAATATCTAGGTGGG + Intergenic
920978236 1:210806345-210806367 GGTCATTTATATATCTTCTTTGG + Intronic
921150933 1:212402444-212402466 AGTCATTTGTATATCTTCTTTGG + Intronic
921446528 1:215253692-215253714 AGTTAATTAGAGATATTATTAGG - Intergenic
921786190 1:219232742-219232764 GGTCATTTATATATCTTCTTTGG - Intergenic
922004545 1:221516461-221516483 ACTTATTTAGATATCTGTTCAGG - Intergenic
922439687 1:225643618-225643640 AGTTATGTAGCTATATAGTTAGG + Intronic
923984249 1:239362747-239362769 AATTAGTTACATCTCTTGTTTGG + Intergenic
924256520 1:242188675-242188697 AGCTATTTTGAGAACTTGTTTGG + Intronic
1064319609 10:14292054-14292076 AATTATTTAGATATCTATTTAGG - Intronic
1065320701 10:24506437-24506459 AGTGATTTGGATAACTTATTTGG + Intronic
1065699756 10:28413470-28413492 TGTCATTTACATATCTTCTTTGG - Intergenic
1065786849 10:29223837-29223859 AGGTATAGAAATATCTTGTTTGG - Intergenic
1065835359 10:29652821-29652843 AGTTATTAGCATATCTTCTTTGG + Intronic
1066474653 10:35733914-35733936 AGTCATTTATGTATCTTCTTTGG + Intergenic
1066517510 10:36179559-36179581 AGTTATTTTGTTTTCTTCTTAGG - Intergenic
1067404928 10:46013366-46013388 AGAAATTTAGATGTCTTGTCGGG - Intronic
1067554201 10:47256547-47256569 AGTGACTCACATATCTTGTTAGG + Intergenic
1067743794 10:48917415-48917437 ATTTCTTTATTTATCTTGTTTGG - Intronic
1068562556 10:58531723-58531745 AGTTATTTAGAATTCCTGTTTGG - Intronic
1068929122 10:62570731-62570753 AGTTATTTACATTTCTTCTCAGG + Intronic
1069116045 10:64507745-64507767 AGTTATATATTTATCTTGTTTGG + Intergenic
1070943991 10:80373147-80373169 AATTTTTGAAATATCTTGTTTGG - Intergenic
1072419947 10:95281810-95281832 AGTTATTTAGATATCTTGTTTGG - Intronic
1073556542 10:104457921-104457943 AATTATATGGACATCTTGTTGGG + Intergenic
1073925962 10:108516240-108516262 AGTTATTTGTATATTTTCTTTGG + Intergenic
1074793961 10:116922351-116922373 ATTAATTTATATATCCTGTTTGG - Intronic
1077605910 11:3612029-3612051 AGCCATTTATATATCTTCTTTGG - Intergenic
1079191340 11:18279435-18279457 AATTATTTTTATATCTTGTCTGG - Exonic
1079245366 11:18748505-18748527 ATTTATTTAGATATTTTTCTGGG + Intronic
1080332082 11:31150671-31150693 AGTAAATTAGATATATTGGTGGG - Intronic
1080343991 11:31300625-31300647 AAGGCTTTAGATATCTTGTTAGG - Intronic
1081531819 11:43966644-43966666 AGCCATTTATATATCTTCTTTGG - Intergenic
1085145993 11:74198032-74198054 AATTATTTATTTATTTTGTTAGG + Intronic
1085383811 11:76144107-76144129 AATTATTTAAATAACTGGTTAGG - Intergenic
1085439612 11:76546889-76546911 TGTTATTAAAAAATCTTGTTTGG + Intronic
1086979773 11:93181605-93181627 TTTTATTTATATATATTGTTAGG + Intronic
1088438578 11:109842847-109842869 TGTCATTTATATATCTTCTTTGG - Intergenic
1089448274 11:118571654-118571676 AGCCATTTATATATCTTCTTTGG + Intronic
1090466172 11:126936101-126936123 AGCTATTTGTATATCTTCTTTGG - Intronic
1090562747 11:127950331-127950353 AGTTGTTTTGTGATCTTGTTTGG - Intergenic
1091551150 12:1535800-1535822 ATTTTCTTAGAAATCTTGTTTGG + Intronic
1092584510 12:9883498-9883520 AGTTTTTTATAAATCTTATTTGG + Intronic
1093695425 12:22154628-22154650 GGTCATTTGGATATCTTCTTTGG - Intronic
1093890128 12:24509831-24509853 AATTATTTAAATATTTTGTGTGG - Intergenic
1094583057 12:31752058-31752080 AGTTATTTAGATATATTTTCTGG - Intergenic
1095880211 12:47127735-47127757 ATTTATTTAGATATGTTTTATGG + Intronic
1096442133 12:51651992-51652014 ATTTATTTAGTCTTCTTGTTTGG - Intronic
1096601234 12:52731208-52731230 GGTCATTGAGATGTCTTGTTTGG - Intergenic
1097157386 12:57022860-57022882 AGTTATTTATTTATTTTTTTTGG - Intronic
1097302133 12:58030187-58030209 GGTTTTTTAGATAATTTGTTAGG - Intergenic
1097711025 12:62917445-62917467 AGGTATGTAGATATCTAATTAGG - Intronic
1097892806 12:64794826-64794848 TGTTATTGAGAAATCTTTTTGGG + Intronic
1098484871 12:71009092-71009114 ATTTATTTAGATATCTGGTCAGG - Intergenic
1099512922 12:83559507-83559529 AGTTCTTTGGAGATCTTCTTGGG + Intergenic
1100560186 12:95740456-95740478 AAATATTAATATATCTTGTTGGG - Intronic
1105244198 13:18633491-18633513 AGTTCTGTAGATATCTATTTAGG - Intergenic
1105540932 13:21316254-21316276 AGTTATTTGTATGTCTTGTTGGG + Intergenic
1106301748 13:28472960-28472982 GGTCATTTATATATCTTCTTTGG - Intronic
1106428091 13:29652683-29652705 AATTATAAAGCTATCTTGTTAGG - Intergenic
1109846791 13:68003737-68003759 TGTTATTTACCTATGTTGTTTGG + Intergenic
1109894788 13:68671218-68671240 TGTTATTTGGATATGTTATTTGG + Intergenic
1109921025 13:69059295-69059317 AGTTATTAAGATACCATTTTTGG + Intergenic
1111308999 13:86456799-86456821 TGTTAATTAAAGATCTTGTTAGG - Intergenic
1111335643 13:86818968-86818990 GGTTGTTAAGATATCTGGTTAGG - Intergenic
1111619790 13:90709710-90709732 GGTTATTTAGATATGGTGATGGG + Intergenic
1112038838 13:95525276-95525298 GGCTATTTACATATCTTCTTTGG + Intronic
1112140783 13:96639591-96639613 TGTTATTTGGATATATTGTGTGG + Intronic
1112866250 13:103903482-103903504 AGTCATTTACGTATCTTATTTGG + Intergenic
1112921342 13:104616402-104616424 ATTTATTCAAATATATTGTTGGG + Intergenic
1113640003 13:111950414-111950436 ATTTAATTAAATATCTGGTTAGG + Intergenic
1114950150 14:27740257-27740279 AATTATTTAGAAAAATTGTTTGG - Intergenic
1114973834 14:28068643-28068665 AGTTTTATAGATCTCTAGTTCGG + Intergenic
1115896315 14:38092295-38092317 AGTGAATTAGATATATTGCTAGG + Intergenic
1116139497 14:40972755-40972777 AGTTATTTAGATAACTTTTCCGG + Intergenic
1116157391 14:41223624-41223646 AGTAATTAAGATATCTAGTAAGG + Intergenic
1117854821 14:60017727-60017749 ATTTATTTAGAGAACTGGTTAGG + Intronic
1119523799 14:75306022-75306044 AGCCATTTATATATCTTCTTTGG + Intergenic
1120203145 14:81560201-81560223 AGTTTTTTTGGTATCTGGTTTGG - Intergenic
1120393184 14:83934360-83934382 AGCTATTGAAATATCTTATTTGG + Intergenic
1121553258 14:94818399-94818421 AGTTATTTATTTATTTTTTTTGG - Intergenic
1124059826 15:26280204-26280226 AGTTATTCATACATCTTCTTTGG + Intergenic
1124224198 15:27876349-27876371 ATTTGATTTGATATCTTGTTTGG + Intronic
1125044212 15:35227694-35227716 AGTTTTTAAGATACATTGTTAGG + Intronic
1125087608 15:35748454-35748476 AGTTATTAAGAAATATTTTTAGG - Intergenic
1125453173 15:39830006-39830028 ATTTATTTAGCTAACTGGTTGGG - Intronic
1125512495 15:40299892-40299914 AGTCACTTATATATCTTCTTTGG - Intronic
1125924044 15:43547181-43547203 AGCTATTTACATGTCTTCTTTGG + Intronic
1126845459 15:52756228-52756250 AGTTAATTTGATAACTTTTTAGG + Intergenic
1127807364 15:62533694-62533716 AGGTATTTAGATGTCTTTCTTGG + Intronic
1128048967 15:64645740-64645762 GGTCATTTAGATATCTTCTTTGG - Intronic
1128531862 15:68458362-68458384 AGTTATTTGTATATCTCCTTTGG - Intergenic
1129619439 15:77130631-77130653 AGTCATTTAGATATGTTAATTGG + Intronic
1130747438 15:86670821-86670843 TGCTATTTAGACATCTTTTTTGG + Intronic
1131747986 15:95470802-95470824 TTTTATTTAGCTATCTTTTTTGG + Intergenic
1133656947 16:7874367-7874389 AGTCATTTGAATATCTTCTTTGG + Intergenic
1135463792 16:22668005-22668027 TGTTTTTTAGAGATCTTTTTAGG + Intergenic
1136015470 16:27397491-27397513 AGTCATTTGCATATCTTGTTTGG - Intergenic
1136018279 16:27420587-27420609 TGTTGTTTGGATATCTTCTTTGG + Intronic
1137422465 16:48347260-48347282 AGTTATTTACATATATTTTAAGG + Intronic
1138055974 16:53833857-53833879 AGCCATTTATATATCTTCTTTGG + Intronic
1138921946 16:61541522-61541544 AATTATTTAGATACCTTTATTGG + Intergenic
1139297369 16:65913770-65913792 GGTTATTTATATCTCTTATTTGG + Intergenic
1140150990 16:72365380-72365402 AGGTATTTATATATCTGGTATGG + Intergenic
1140219320 16:73032551-73032573 AGTTATTTTGGTCTCTTTTTGGG - Intronic
1140944412 16:79754580-79754602 AGTTATTTAGAAAACTTTCTTGG + Intergenic
1143351833 17:6294287-6294309 AGTCATTTATATATCTTCTTTGG - Intergenic
1144798413 17:17908646-17908668 AGTCATTTATATATCTTCTTTGG - Intronic
1144951256 17:18994844-18994866 ATTTATTTATATACTTTGTTTGG - Intronic
1148943374 17:51235476-51235498 AGTTCTTTTTATATATTGTTAGG - Intronic
1149335471 17:55631304-55631326 AGCTATTCATATATCTTCTTTGG + Intergenic
1149438086 17:56651128-56651150 AGATATTTATTTAACTTGTTTGG + Intergenic
1150503817 17:65677913-65677935 ATTTATTTATTTATCTTTTTTGG - Intronic
1150533335 17:66009331-66009353 TGTTATTTGTATATCTTCTTTGG + Intronic
1152050750 17:77974264-77974286 AGCTATTTGTATATCTTTTTTGG - Intergenic
1153105891 18:1525995-1526017 AGTTTTTTAGATCTCCTATTTGG - Intergenic
1154393364 18:13963618-13963640 ATTTGTTTATATATCTTTTTTGG + Intergenic
1155650944 18:28140887-28140909 ATATATATATATATCTTGTTTGG - Intronic
1156056979 18:33018142-33018164 AGTCATTTATATATCTTCTTTGG - Intronic
1156156655 18:34310688-34310710 ATTTATGTAGATATCTTTTGAGG + Intergenic
1156741170 18:40330358-40330380 AGTCATTTAGATATCTTTTTTGG + Intergenic
1156781754 18:40858527-40858549 ATTTATTAAGATATCTAGTTTGG - Intergenic
1157063195 18:44317747-44317769 AGTTATTTTTATTTCTAGTTTGG + Intergenic
1157337088 18:46748602-46748624 AGCTATTTGCATATCTTCTTTGG - Intronic
1157463977 18:47929055-47929077 AATTCTTTAAATATCTTGTATGG + Intronic
1157875017 18:51264765-51264787 AGCTATTTGTATATCTTCTTTGG - Intergenic
1157955872 18:52096920-52096942 AGTTGATTACATATATTGTTTGG + Intergenic
1158837490 18:61346317-61346339 AGTTATTTTGTTATCTTCTATGG - Intronic
1158905469 18:62007041-62007063 GGTTATTTGTATATCTTCTTTGG - Intergenic
1159415240 18:68138548-68138570 AGATAGATAGATATCTTTTTTGG + Intergenic
1159885232 18:73897296-73897318 AATTTTTTAGTTATTTTGTTAGG - Intergenic
1163074138 19:14874099-14874121 AGTTATTTAAATAGTTTTTTGGG + Intergenic
1163982964 19:20918816-20918838 ATCTATTTAGATATCCAGTTAGG - Intergenic
1164772737 19:30823759-30823781 AGTCATTTGTATATCTTTTTTGG - Intergenic
1166639329 19:44481782-44481804 GGTTATTTTGATATCTTATAAGG - Intronic
1167063635 19:47167664-47167686 TGTTCTTTAAATATCTGGTTGGG + Intronic
1168439415 19:56351104-56351126 AGTTATTAAGAAATCATTTTAGG + Intronic
925262530 2:2541022-2541044 AGTTATTCTGATATCTTTTCCGG + Intergenic
925315082 2:2915979-2916001 ATTTATTTATATGTCTTCTTTGG + Intergenic
926532011 2:14059908-14059930 GGTCATTTGCATATCTTGTTGGG - Intergenic
927204996 2:20602936-20602958 AGCCATTTGTATATCTTGTTTGG - Intronic
928240861 2:29584528-29584550 TATTTTTTGGATATCTTGTTTGG - Intronic
928746306 2:34419579-34419601 AGTTATTTGGTTATCCTATTTGG + Intergenic
931002379 2:57801599-57801621 GGTTTTATAAATATCTTGTTTGG - Intergenic
931508738 2:62963546-62963568 AGTTAAATAGATAGCTTCTTAGG + Intronic
932179723 2:69635156-69635178 AGCTATTTGTATATCTTCTTTGG - Intronic
932204883 2:69870721-69870743 AGCCATTTATATATCTTCTTTGG - Intronic
932746649 2:74339223-74339245 ATTTTTTTAGAAATATTGTTAGG + Intronic
933677323 2:85068358-85068380 AGTTATTTGTATATCCTCTTTGG + Intergenic
934201100 2:89886142-89886164 AGTTATTAAGATATTATTTTAGG + Intergenic
934484694 2:94694253-94694275 AATAATTTTGATATTTTGTTAGG - Intergenic
935519262 2:104083629-104083651 AGTTATTTATATATCATCTTTGG + Intergenic
936580080 2:113692327-113692349 AGCCATTTATATATCTTCTTAGG - Intergenic
936742676 2:115533054-115533076 AGTTTTATAGTTTTCTTGTTTGG + Intronic
936990379 2:118357817-118357839 GGTTATTTGTATATCTTCTTTGG + Intergenic
937385111 2:121422799-121422821 AGTTATCTACAAATCGTGTTTGG - Intronic
937395131 2:121528501-121528523 ACTTATTTAAATATCTTGCATGG + Intronic
940309762 2:152265566-152265588 ACTTTTATAGATATGTTGTTGGG - Intergenic
940684104 2:156824682-156824704 AGTTATTTAGAAAGATAGTTAGG + Intergenic
940851885 2:158695302-158695324 AGCTATTTATATATCATCTTTGG - Intergenic
941803309 2:169685390-169685412 GGCTATTTATACATCTTGTTTGG + Intronic
941940652 2:171033977-171033999 TGGTCTTTATATATCTTGTTTGG - Intronic
943052414 2:182931835-182931857 GGTTATTTCTATATCTTCTTTGG - Intronic
943182087 2:184558117-184558139 ATTTATTTTGATATCTTCCTTGG + Intergenic
944324539 2:198388599-198388621 AGTCTTTTAGACATCTTCTTTGG - Intronic
944531424 2:200671516-200671538 AGCCATTTATATATCTTCTTTGG - Intronic
945843876 2:214920050-214920072 AGCTATTTTTATATCTTCTTTGG - Intergenic
946915886 2:224520837-224520859 AACTATTTAGATATGTTGGTAGG - Intronic
947008632 2:225540234-225540256 ACTTATTCAGATATCTTTTCAGG + Intronic
947763143 2:232618365-232618387 AGCTATTTGTATATCTTCTTTGG - Intronic
1169615362 20:7437596-7437618 AATTAGTTAGATATTTTGTTTGG - Intergenic
1170091224 20:12591710-12591732 AGATATTTAGGTAATTTGTTTGG - Intergenic
1170810372 20:19669624-19669646 CGTTCTTTAGTTTTCTTGTTGGG - Intronic
1171110538 20:22477113-22477135 AGTTTTTTAGTTATGATGTTAGG - Intergenic
1171247879 20:23627801-23627823 GGCTATTTACATATCTTCTTTGG + Exonic
1172051159 20:32119462-32119484 AGTCATTCATATATCTTCTTTGG + Intronic
1172421443 20:34821926-34821948 AGTTTTTTAAATTTCTGGTTTGG - Intronic
1172451301 20:35025539-35025561 AATTATTTATATATCTTCTTTGG + Intronic
1172812965 20:37663406-37663428 AGTCATTTGCATATCTTCTTTGG + Intergenic
1173129301 20:40373512-40373534 AGTTATTAAAATATATTGTTTGG - Intergenic
1174235836 20:49090864-49090886 ATTTATTTAGAAATTTTGTTAGG + Intronic
1177641509 21:23849856-23849878 TGTTATTTTGATTGCTTGTTGGG + Intergenic
1177714359 21:24820004-24820026 AGTTAGTTAGTTATTATGTTAGG - Intergenic
1178074803 21:29005187-29005209 AGTAATTTAGAAAATTTGTTTGG - Exonic
1179143166 21:38745080-38745102 AGATATTTAGATATCTGTGTAGG - Intergenic
1179269059 21:39834996-39835018 AGCTATTTGTATATCTTATTTGG + Intergenic
1179432319 21:41331215-41331237 AGTTATTTGTATGTCTTCTTTGG + Intronic
1181727825 22:24823902-24823924 ATTTATTTAAATATATTTTTAGG - Intronic
1182121801 22:27792242-27792264 ATTCATTTAGATTTCTTGTGAGG - Intronic
1182170836 22:28227572-28227594 AGCTATTTATGTATCTTGTTTGG - Intronic
1183486985 22:38093569-38093591 AGCTATTTATAGATCTTCTTTGG - Intronic
1183846294 22:40543719-40543741 ATTTATTTAGATCTTTTGTAAGG - Intronic
1183887604 22:40897867-40897889 GGTTATTTGTATATCTTATTTGG + Intronic
1184475497 22:44718778-44718800 GGTCATTTAGATATCTTCTTTGG + Intronic
1184995315 22:48201807-48201829 GGTTATTTGCATATCTTCTTTGG - Intergenic
949859273 3:8491009-8491031 AGGTAGTTAGCTATCATGTTTGG - Intergenic
950756826 3:15180498-15180520 AGTTATTTTAATAGATTGTTGGG - Intergenic
951385708 3:22039721-22039743 AGTTATTTAGTTATAATATTCGG - Intronic
951703222 3:25517352-25517374 AGTTATTTGTATATTTTCTTTGG - Intronic
952178492 3:30893154-30893176 ACTTATTTAAATATTTGGTTAGG - Intronic
952706940 3:36388083-36388105 GGTTATTTGTATATCTTCTTTGG + Intronic
953865806 3:46582272-46582294 ATTTATTAAGCAATCTTGTTGGG - Exonic
954550150 3:51474418-51474440 ATTTATTTAGTTATATTTTTGGG - Intronic
954585888 3:51736239-51736261 AGCTATTAATATATCTTCTTTGG + Intergenic
956141339 3:66149734-66149756 AATTATATAGTTATCTTATTAGG - Intronic
957034410 3:75280684-75280706 AGATATTTAAATATCTTTTATGG + Intergenic
957634762 3:82766782-82766804 AATCATTTAGTTCTCTTGTTTGG - Intergenic
957648727 3:82970707-82970729 AGTTATTTTGTTATTTTCTTAGG - Intergenic
957703811 3:83753973-83753995 AGTCATTTATATGTCTTCTTTGG + Intergenic
959421279 3:106132547-106132569 AGTTGTTGAGAAATTTTGTTGGG + Intergenic
959897491 3:111620841-111620863 TGTTATTTAGGGACCTTGTTGGG - Intronic
960231834 3:115237546-115237568 AGTTTTTAAAATATCTTTTTTGG - Intergenic
960485348 3:118245447-118245469 AGTCATTTAGATTTCTGCTTAGG - Intergenic
960691903 3:120355051-120355073 AGTGATTTTTATATCTTTTTTGG - Intergenic
961091825 3:124119372-124119394 ATTTATTTTAATATCTTCTTGGG - Intronic
961258296 3:125577362-125577384 AGTCATTTGTATATCTTCTTTGG - Intronic
961418293 3:126778545-126778567 GGCTATTTATATATCTTTTTTGG + Intronic
961682306 3:128607606-128607628 ACTTATTTAGAAATGTGGTTTGG - Intergenic
962516459 3:136156552-136156574 ATTTATTAAGCCATCTTGTTGGG - Intronic
963280161 3:143376462-143376484 AGTGATATAGGTATCTTGATTGG + Intronic
963879895 3:150517448-150517470 GGTTATTTGCATATCTTCTTTGG - Intergenic
965385366 3:168039208-168039230 ATTTATTGAAATATCTTTTTTGG - Intronic
965462198 3:168979704-168979726 AGTTTTTTTGATATGTTTTTTGG + Intergenic
966265111 3:178030924-178030946 AGTTATTTAGCTAACATGTCTGG - Intergenic
967438643 3:189480605-189480627 AGTTATTTAGAAATCAAGATCGG - Intergenic
967459439 3:189728426-189728448 CAATATTTATATATCTTGTTTGG - Intronic
967659904 3:192093345-192093367 AGCTATTTTGAGAGCTTGTTTGG - Intergenic
968257775 3:197293732-197293754 AGTTATCTAGTTATCTGTTTGGG - Intronic
970198709 4:13579235-13579257 AGTTATAAAGATTTCTTGTATGG + Intronic
971005356 4:22368592-22368614 GGTCATTTGGATATTTTGTTCGG - Intronic
971115021 4:23635631-23635653 AGCTATTTGTATATCTTCTTTGG - Intergenic
971634810 4:29044857-29044879 AATTATTTAGATTTATTATTAGG + Intergenic
972058921 4:34842380-34842402 ACATACTTAGATTTCTTGTTAGG + Intergenic
972143617 4:35993713-35993735 AGCCATTTAGATTTCTTCTTTGG - Intronic
972194265 4:36634029-36634051 AGCCTTTTAGATATCTTTTTTGG - Intergenic
972423977 4:38915519-38915541 ATTTATTCAGCCATCTTGTTAGG + Intronic
973713032 4:53648390-53648412 AGCCATTTATATATCTTCTTTGG + Intronic
974059759 4:57021234-57021256 AGTTATTTTTATTTCTTCTTTGG - Intronic
974172606 4:58285964-58285986 AGTGGTTTAGATTTCTTTTTTGG + Intergenic
974826873 4:67142494-67142516 AGTTATTTAGGAAGCTTTTTAGG + Intergenic
975175042 4:71278726-71278748 ATTTATTTATATGTCTTCTTTGG + Intronic
975986424 4:80204793-80204815 AGCTATTTAGAGATCCTGTGGGG + Intergenic
976457198 4:85262047-85262069 AGTTATTTATATTTGTTGTGAGG + Intergenic
976581727 4:86744899-86744921 TATTATTTATATTTCTTGTTAGG - Intronic
976898433 4:90141011-90141033 AGATAGATAGATATCTTGCTGGG - Intronic
977018939 4:91734541-91734563 GGCCATTTATATATCTTGTTTGG - Intergenic
977870719 4:102087666-102087688 AGTTATCTAGATTTTCTGTTGGG + Intergenic
978203845 4:106055768-106055790 AGTTATTAATATATCTTTTAAGG + Intronic
978203847 4:106055821-106055843 AGTTATTAATATATCTTTTAAGG + Intronic
978283312 4:107043397-107043419 AGTTATTAAGAAATCTGATTTGG + Intronic
980431262 4:132699714-132699736 GGTTATTTGTATATCTTCTTTGG - Intergenic
981020672 4:140024656-140024678 AGCTATTTATATATATTTTTTGG - Intronic
981117722 4:141011519-141011541 AGTTATTTAGACATGTTGTCTGG - Intronic
981901250 4:149866570-149866592 GGCTATTTATATATCTTCTTTGG + Intergenic
983405082 4:167317758-167317780 AATTATTTAGATAGTTTGTAAGG - Intergenic
984114416 4:175662142-175662164 ATATATTTAGATATTTTCTTTGG - Intronic
984484992 4:180356818-180356840 ATTTATTTAGTTAGTTTGTTTGG - Intergenic
987062740 5:14258070-14258092 AGTTACTTAGGTGTCTAGTTAGG - Intronic
987727486 5:21720903-21720925 TGTCATCTAGATATTTTGTTAGG + Intergenic
988010586 5:25476859-25476881 ATTTATTTAAATATTTTGATAGG + Intergenic
988504604 5:31810871-31810893 AGTTATATAGATTTCTTCATGGG + Intronic
988788692 5:34587444-34587466 ACTTGTTTAGATTTCTTTTTCGG + Intergenic
989477777 5:41893911-41893933 GGTCATTTACATATCTTCTTCGG - Intergenic
990997666 5:61748817-61748839 ATTTATTTATTTATCTTGCTTGG - Intronic
992245091 5:74812685-74812707 GGTTATTTGTATATCTTCTTTGG - Intronic
993092921 5:83449291-83449313 AGTCATTTGTATATCTTTTTGGG + Intergenic
993811267 5:92479672-92479694 ATTTATTTTGAGGTCTTGTTTGG - Intergenic
993956518 5:94241126-94241148 TTTTATTTGGAAATCTTGTTTGG + Intronic
994428876 5:99629567-99629589 AATTAATTAGATATTTTATTTGG + Intergenic
994537718 5:101052542-101052564 ATTTATTTGTATATCTTCTTTGG + Intergenic
994735313 5:103546731-103546753 AGTTATTTTGCTTTTTTGTTAGG - Intergenic
994744620 5:103663418-103663440 TGTTATTTAGATATCCTCTTTGG + Intergenic
995314079 5:110747738-110747760 TGTTTTCTAGATATATTGTTTGG + Intronic
995976438 5:118041605-118041627 AACTATTTAGACATCTTGGTCGG + Intergenic
996419211 5:123243094-123243116 ATTTTTTTAAAAATCTTGTTAGG + Intergenic
997183150 5:131853705-131853727 AGCTATTTGTATATCTTTTTTGG - Intronic
997581909 5:135023302-135023324 GGTCATTTGTATATCTTGTTTGG + Intergenic
997895641 5:137714048-137714070 GGCTATTTCTATATCTTGTTTGG - Intronic
998259347 5:140617091-140617113 GGTCATTTATATATCTTCTTTGG - Intergenic
998875619 5:146596110-146596132 AGTCATTTACATATCTTCTATGG - Intronic
999698892 5:154210013-154210035 AGTTATTTAAAAAGCCTGTTTGG + Intronic
1000433332 5:161178238-161178260 AGTTATTTGTGTATCTTTTTTGG + Intergenic
1000549599 5:162643874-162643896 AGTTATTAAAATATATTGATAGG - Intergenic
1000945589 5:167419159-167419181 AATTATTTAAATATGTTGGTAGG + Intronic
1002627686 5:180542599-180542621 AGTTATTTTGATTTCCTGGTAGG + Intronic
1002812452 6:644682-644704 AGTTATTTACATATTTTAGTAGG + Intronic
1004535666 6:16498782-16498804 GGCTATTTATATATCTTCTTTGG + Intronic
1004579571 6:16936536-16936558 AGCTATTTGTATATCTTCTTAGG - Intergenic
1006948778 6:37804016-37804038 AGCTATTTATATACCTTGTTTGG + Intergenic
1008371952 6:50742657-50742679 TGTTATTTAAATATCTGTTTTGG + Intronic
1008427494 6:51376455-51376477 ACTTATTTAGCTATCTCCTTAGG + Intergenic
1008575788 6:52858856-52858878 AGCTTTTTAAAAATCTTGTTTGG - Intronic
1008955150 6:57207593-57207615 ATTTATTTATTTATTTTGTTTGG - Intronic
1009987886 6:70803980-70804002 AGTTCTGTAGATGTCTTATTAGG + Intronic
1010321817 6:74519526-74519548 ATTTATTTACATAAATTGTTGGG - Intergenic
1010435618 6:75826660-75826682 AGGTATTAATATATCTGGTTTGG - Intronic
1010795997 6:80117450-80117472 AGATATTTAGACATTTTGTTGGG + Intronic
1011805166 6:91063022-91063044 AATTATTTAGATTTGTTGTGCGG + Intergenic
1012120720 6:95363419-95363441 AATTATTTAAATATCTTTTGGGG - Intergenic
1012319573 6:97825972-97825994 AGTGATTTACATATGCTGTTAGG - Intergenic
1012779485 6:103539412-103539434 AGTCATTTTCATATCTTGGTTGG - Intergenic
1012819740 6:104070841-104070863 AGGTATTTGGATATATGGTTTGG + Intergenic
1013499882 6:110738540-110738562 AGTTGTTTTTATATTTTGTTTGG - Intronic
1014562631 6:122909681-122909703 AGTTTTATAGAAATCATGTTAGG + Intergenic
1014628108 6:123754185-123754207 TGTTATTTGTATATCCTGTTAGG + Intergenic
1014641261 6:123913611-123913633 TGTTAATTACATATTTTGTTAGG + Intronic
1015135864 6:129869690-129869712 AGTCATTTATAGATCCTGTTAGG + Intergenic
1015262503 6:131254459-131254481 AGTTATTAAGTTTTCTTGTGAGG - Intronic
1015831885 6:137378620-137378642 ACTTATTCTAATATCTTGTTTGG - Intergenic
1016006624 6:139095441-139095463 ATTTATTTATTTATTTTGTTTGG - Intergenic
1016009812 6:139127732-139127754 AGTTCTTTAGAAAACTTCTTGGG - Intergenic
1016714433 6:147207684-147207706 AGTTATGAAATTATCTTGTTGGG - Intronic
1018403663 6:163453389-163453411 TATTATTTAAATATCTTCTTCGG - Intronic
1018498658 6:164378734-164378756 ATTTATTTGGATATGTTCTTGGG + Intergenic
1019086508 6:169482684-169482706 AGTTCTGTAGATATCTTATCAGG - Intronic
1020873257 7:13661299-13661321 TGTTATTTGTATATCTTTTTTGG - Intergenic
1021224969 7:18015800-18015822 AGTTATTTAGAAAACATTTTTGG + Intergenic
1021355070 7:19644288-19644310 AGTTCTTTTTATATCTCGTTGGG + Intergenic
1021736241 7:23640601-23640623 AATTTTATAGATTTCTTGTTTGG - Intronic
1022058572 7:26767954-26767976 AGTTCTATAGATGTCTTATTAGG + Intronic
1022414056 7:30163172-30163194 AGTTATTTAAATGCCATGTTTGG - Intergenic
1023040584 7:36169515-36169537 GGTTATTTGTATATCTTCTTTGG + Intronic
1023574764 7:41615367-41615389 AGTTATTTACAAATGGTGTTTGG + Intergenic
1023915696 7:44587252-44587274 ATTTCTTTATTTATCTTGTTTGG - Intergenic
1025273689 7:57552726-57552748 AGTTAATCAGATGTCCTGTTAGG + Intergenic
1027515972 7:79142239-79142261 TGTTATTTGGATATCTTGATTGG + Intronic
1028124726 7:87099672-87099694 TGATATTTTGATATTTTGTTTGG + Intergenic
1028424227 7:90668297-90668319 AGCTATTTGCATATCTTCTTTGG + Intronic
1028572088 7:92301470-92301492 GGTTATTTGTATATCTTGTTTGG + Intronic
1028897384 7:96057371-96057393 AGTGATTTAGAGATCTTTCTAGG + Intronic
1029338771 7:99925741-99925763 GGTTATTTGTATATCTTCTTTGG - Intronic
1029639672 7:101812855-101812877 AATTATTTAGTTACCTTATTTGG + Intergenic
1030329112 7:108254318-108254340 AGATATTTGTATATCTTCTTTGG - Intronic
1030418088 7:109270820-109270842 AGTTGTTTGTATATCTTCTTTGG + Intergenic
1031147782 7:118016387-118016409 AATTATTTAGAGATTTTGATGGG - Intergenic
1031780876 7:125962762-125962784 AGTTATTTGGATGTCTTCTTTGG - Intergenic
1031905460 7:127455732-127455754 AGTTATCTATATATCTGTTTTGG - Intergenic
1034848269 7:154468042-154468064 GGTTATTTTTATATCTTCTTTGG - Intronic
1035222777 7:157415935-157415957 AGATATTTAGAAAACATGTTTGG + Intronic
1036102682 8:5804084-5804106 AGGTATTTCCATATCTTTTTAGG - Intergenic
1037080994 8:14786368-14786390 ATTTATTCAAATATATTGTTGGG - Intronic
1038599353 8:28923894-28923916 GGTCATTTATATATCTTCTTTGG + Intronic
1039264726 8:35812117-35812139 AGTTATTTAGTTGTGATGTTAGG - Intergenic
1039523937 8:38196748-38196770 AGCCATTTGTATATCTTGTTTGG + Intronic
1039684864 8:39789897-39789919 AGTTATTTGCATATCTTATTTGG - Intronic
1039770447 8:40681052-40681074 AGTTACTCAGAGATCTTGTCTGG + Intronic
1040503708 8:48027807-48027829 GGCTATTTATATATCTTCTTTGG + Intronic
1040565276 8:48560428-48560450 AATTCTTTTGATATGTTGTTTGG + Intergenic
1041057663 8:54003996-54004018 GGTTATTTTTATATCTTATTCGG - Intronic
1042922713 8:73935506-73935528 GGTTATTTGTATATCTTCTTTGG + Intergenic
1042999694 8:74742774-74742796 AATTTTATAGACATCTTGTTGGG + Intronic
1043010387 8:74874235-74874257 AGTTATGAAGATATTTTCTTAGG - Intergenic
1043141915 8:76601331-76601353 AGTTATTGAGATGTATTGTCAGG + Intergenic
1043461604 8:80465985-80466007 AGATATTTAGATATATATTTGGG - Intergenic
1045607239 8:103790699-103790721 GGCTATTTATATATCTTCTTTGG + Intronic
1045923219 8:107556977-107556999 AATTATTTAAATATCTTTTGGGG + Intergenic
1046394309 8:113620518-113620540 AGCTATTTTTATATCTTCTTTGG - Intergenic
1047123278 8:121930659-121930681 AATTCTTTAAATAACTTGTTTGG - Intergenic
1047992455 8:130300311-130300333 ATTCATTTAGATGTCTTGTTTGG - Intronic
1048727485 8:137402808-137402830 AGTTATTTAAATTTCTTTATAGG - Intergenic
1048872179 8:138808353-138808375 ATTTATTTACATATTTAGTTTGG - Intronic
1050813599 9:9780463-9780485 TGTTATCTATATATCTTCTTTGG - Intronic
1051754274 9:20379478-20379500 AGTAATTTAGATTTGTTTTTAGG - Intronic
1052019775 9:23512203-23512225 AGTTATTTAAAGATCTAGTTGGG - Intergenic
1052071540 9:24087838-24087860 AATCTTTTAGATATCTTTTTGGG + Intergenic
1053086987 9:35233511-35233533 AGTTATTTACTTATTTTTTTTGG + Intronic
1055445760 9:76380908-76380930 AGGTTTTTAGACATCTTTTTAGG - Intergenic
1055820368 9:80254649-80254671 AGTAATTAAGATCTCTTTTTAGG - Intergenic
1056234533 9:84580323-84580345 AGTTATCTACATATTTTATTTGG - Intergenic
1056497036 9:87167746-87167768 ATTTTTATAGATATCTAGTTAGG - Intergenic
1058278336 9:103076689-103076711 AGCTATTCATATATCTTCTTTGG + Intergenic
1058304103 9:103415176-103415198 AGTCATTTAAATATCTTTTAAGG - Intergenic
1058513873 9:105750123-105750145 AGGTATTTGTATATCTTCTTTGG + Intronic
1059320801 9:113467508-113467530 CATTATTTATATATCTTCTTTGG + Intronic
1060843308 9:126812693-126812715 GGTTATTTGTATATCTTCTTTGG + Intronic
1186121266 X:6363827-6363849 AGTTATTTAGAATTCTTGTCAGG - Intergenic
1186677920 X:11839375-11839397 AGTTATTTGTATGTCTTTTTTGG + Intergenic
1187718164 X:22124262-22124284 AGTAATTTAGATAGCTCATTGGG + Intronic
1188369764 X:29354748-29354770 ATTTGTTTATATATCTTGTAGGG + Intronic
1188644226 X:32544246-32544268 AGTTATTCAAATATATTATTTGG - Intronic
1188662611 X:32777979-32778001 AGTTTTTTAGAATTCTTGCTGGG - Intronic
1189520420 X:41761304-41761326 AGTTATTTAGATGTTCTGTGAGG - Intronic
1189541482 X:41995629-41995651 AGCCATTTATATATCTTCTTTGG - Intergenic
1189805800 X:44734433-44734455 AGTGATTTATATATCTTGGAAGG + Intergenic
1189880264 X:45483770-45483792 AGACATTTATATATCTTCTTTGG + Intergenic
1190600384 X:52086694-52086716 AGTTCTGTAGATATCTTATCAGG + Intergenic
1191683709 X:63867282-63867304 AGTCATTTGTATATCTTCTTAGG + Intergenic
1191764022 X:64677065-64677087 GGCTATTTATATATCTTCTTTGG - Intergenic
1192956710 X:76078831-76078853 AGTTCTTTAGTTGTGTTGTTAGG - Intergenic
1193422582 X:81300559-81300581 AGCCATTTATATATCTTCTTTGG + Intergenic
1193763853 X:85501151-85501173 AGTTATTAAACCATCTTGTTTGG + Intergenic
1194931214 X:99889428-99889450 AATTATTTTTATATGTTGTTGGG - Intergenic
1195005209 X:100678938-100678960 ATTTATCTAGAAATCATGTTTGG - Intronic
1195128683 X:101833696-101833718 GGTTATTTGTATATCTTCTTTGG + Intronic
1195145725 X:102015188-102015210 GGTCATTTATATATCTTCTTTGG - Intergenic
1195975599 X:110522720-110522742 ATTTATTAAGCAATCTTGTTGGG - Intergenic
1196063540 X:111437529-111437551 AGTTATTTGGGTGTCTTGTGTGG + Intergenic
1196298961 X:114032425-114032447 GGTCATTTATATATCTTCTTTGG - Intergenic
1196539726 X:116893532-116893554 AATTATTTTGAAATCTTTTTTGG + Intergenic
1197169732 X:123418609-123418631 AGCCATTTATATATCTTCTTTGG - Intronic
1197485605 X:127046492-127046514 TGTTATGTATATATCTTCTTTGG + Intergenic
1199828783 X:151528152-151528174 AGTTATTTAAACATCTTGCAGGG + Intergenic
1200096175 X:153664265-153664287 TATTATTTATATATCTTATTTGG - Intergenic
1200843626 Y:7809314-7809336 AGGTATTGTGATATATTGTTTGG - Intergenic
1200865881 Y:8042865-8042887 AGTTATTTTGATATCTACCTGGG + Intergenic
1201951097 Y:19565095-19565117 AGTCATTTATATGTCTTCTTTGG - Intergenic