ID: 1072423202

View in Genome Browser
Species Human (GRCh38)
Location 10:95307041-95307063
Sequence CTCAAAGGAGTTCAGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072423202_1072423209 28 Left 1072423202 10:95307041-95307063 CCCTGGGGCTGAACTCCTTTGAG No data
Right 1072423209 10:95307092-95307114 TAAGAATACCTTCCTCACCGAGG No data
1072423202_1072423205 2 Left 1072423202 10:95307041-95307063 CCCTGGGGCTGAACTCCTTTGAG No data
Right 1072423205 10:95307066-95307088 TCAGTTCCCTCACCTGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072423202 Original CRISPR CTCAAAGGAGTTCAGCCCCA GGG (reversed) Intergenic