ID: 1072424167

View in Genome Browser
Species Human (GRCh38)
Location 10:95315337-95315359
Sequence CTGGGTTCCTTCTGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072424167_1072424171 7 Left 1072424167 10:95315337-95315359 CCTGTTTTTCAGAAGGAACCCAG 0: 1
1: 0
2: 1
3: 13
4: 234
Right 1072424171 10:95315367-95315389 GAGTAGAAGTAACATGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072424167 Original CRISPR CTGGGTTCCTTCTGAAAAAC AGG (reversed) Intronic
902735286 1:18396710-18396732 CTGCTTTCCTTCTGAAAGTCTGG + Intergenic
903176715 1:21585908-21585930 CCGGCTTCCTTCTGATAAACAGG - Intergenic
903948156 1:26977247-26977269 CATGTTTCTTTCTGAAAAACTGG + Intergenic
906042325 1:42797501-42797523 CTGGTTTCCTTCTGGGAATCTGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907764275 1:57393165-57393187 CTTGGTTTCTTATGAAAAATGGG + Intronic
907899947 1:58731849-58731871 CTGTGTTGGTTCTGGAAAACAGG + Intergenic
908226284 1:62059314-62059336 CTGGGTGCCCTTTGAAAAATCGG + Intronic
908682785 1:66681462-66681484 CAAGGTCCCTTCTGAAAATCTGG - Intronic
909451187 1:75799292-75799314 CTTGGTTCTATCTGTAAAACAGG - Intronic
910555559 1:88528477-88528499 CTAGGGTCCTTATGAAAAAAAGG + Intergenic
911159598 1:94671411-94671433 CTGAGTTGCTTCTCAGAAACTGG - Intergenic
915699813 1:157781181-157781203 CTGGGTTCCATGAGAACAACAGG + Intergenic
916024815 1:160824190-160824212 CTCTCTTCCTTCTGAGAAACTGG - Exonic
919170904 1:193952838-193952860 CTGGGTTGCTTTTTAAAAAACGG - Intergenic
919981632 1:202645563-202645585 CATGGTTCCTTCTGATAAAATGG + Intronic
1063016600 10:2084151-2084173 CTGGTGTCCTTATAAAAAACAGG + Intergenic
1063961198 10:11306843-11306865 CTGGCTTCCTATTTAAAAACTGG - Intronic
1064175151 10:13068112-13068134 CGGGGTTCCATGAGAAAAACAGG - Intronic
1065330466 10:24592002-24592024 CTTGGTTCCATCTGAAAGAAAGG + Exonic
1067375154 10:45720884-45720906 CTGTTTTCCTTCTGACAAATGGG - Intergenic
1067882972 10:50062526-50062548 CTGTTTTCCTTCTGACAAATGGG - Intergenic
1069752541 10:70753579-70753601 CTGTGTCTCGTCTGAAAAACAGG - Intronic
1070845792 10:79521935-79521957 CTGGATTCCTTCTGTACAACTGG + Intergenic
1070928001 10:80238383-80238405 CTGGATTCCTTCTGTACAACTGG - Intergenic
1072424167 10:95315337-95315359 CTGGGTTCCTTCTGAAAAACAGG - Intronic
1072609094 10:97004782-97004804 ATGGGATCCTTCTGTACAACGGG - Exonic
1072946561 10:99815919-99815941 CTGGGTTCTTCCTCAAACACAGG + Intronic
1073224672 10:101907765-101907787 ATCGGTTACTGCTGAAAAACAGG - Intronic
1073345107 10:102776986-102777008 CAGGGGTCTTTTTGAAAAACTGG - Intronic
1075045867 10:119146328-119146350 CTGGGTTTTTCCTGAAATACTGG + Exonic
1076207114 10:128612256-128612278 CTGGGTTCCTTCAGCAATTCAGG - Intergenic
1076404079 10:130200983-130201005 GTGGGTTCCAGCTGGAAAACTGG - Intergenic
1077720422 11:4622742-4622764 CTTTGTTCCTTCTGAAAAGATGG - Intergenic
1079228964 11:18633380-18633402 GTGGGTACCATCTGAAAATCTGG + Intronic
1080001748 11:27358627-27358649 ATGGGTTCCTTCTGCAAGACTGG - Intronic
1080824456 11:35836184-35836206 CTGGTTTCCTTGTTAATAACGGG - Intergenic
1083278703 11:61612076-61612098 CTGGTGTCCTTCTGAAAAGAAGG + Intergenic
1083679696 11:64345429-64345451 CAGGCATCCTTCTGTAAAACAGG + Intronic
1083804736 11:65066991-65067013 CTGGGCTCTTACTGAAACACTGG - Intronic
1085176325 11:74491646-74491668 CTGGGTTCTTTCTGCAATAAAGG - Intergenic
1086016400 11:82172737-82172759 CTTCCTTCCTTCTGAAATACAGG - Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1088927443 11:114316611-114316633 TTGGGACCCTTCTGGAAAACAGG + Intergenic
1089267291 11:117273837-117273859 CTGGGATCCTTCAGACCAACTGG + Intronic
1095750397 12:45704191-45704213 CTGTGTTCCTTCTGAGCAATTGG - Intergenic
1095784389 12:46093646-46093668 CTGGGTAACTTCTGAAATAATGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098213313 12:68188582-68188604 CTGGGCTCCTTCAGGAAACCTGG + Intergenic
1098950951 12:76640001-76640023 CTGGAGACCTTCTGAGAAACAGG - Intergenic
1099464068 12:82960851-82960873 CTGGTTTCTATATGAAAAACAGG - Intronic
1099825913 12:87778189-87778211 CTGCATTCCTTCTGGAAACCAGG + Intergenic
1100985303 12:100197899-100197921 CTGGCTTCCTTCGGGGAAACAGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101732228 12:107436311-107436333 CTGTGTTCCTTCTGGGAATCAGG + Intronic
1102416234 12:112765311-112765333 CTGCCTTTCTTCTGGAAAACTGG - Intronic
1102577631 12:113866460-113866482 GTGGGTTCCATCTGAAACGCAGG - Intronic
1102720378 12:115010821-115010843 ATGGGTGCCTCATGAAAAACTGG + Intergenic
1102919965 12:116784562-116784584 CTGAGTTCCTTCTTGAAAATGGG - Intronic
1104783716 12:131436797-131436819 CTGGGTTCCTCCTAAACCACAGG + Intergenic
1107600382 13:42006554-42006576 CTGGAGTCCCTCTGAAGAACTGG - Intergenic
1108287291 13:48921057-48921079 TTGGGGTCCTCCTGAGAAACAGG - Intergenic
1110137233 13:72082958-72082980 ATGGGTTCCTTCTGAACACAGGG - Intergenic
1110591325 13:77264734-77264756 CTGTGGTCCTTCTGTAATACTGG - Intronic
1111504257 13:89165798-89165820 CTTCTTTCCATCTGAAAAACAGG + Intergenic
1111795308 13:92911660-92911682 CTTGGTTACTTCTGACAAAGGGG - Intergenic
1112476270 13:99733696-99733718 CTCTGTTCCTTCTGAACAACTGG + Intronic
1112996655 13:105582638-105582660 TTGAGTTACTTCTGAAGAACAGG - Intergenic
1113325527 13:109277753-109277775 CAGGGTTCCTTCTGAAGAACAGG - Intergenic
1113692004 13:112317735-112317757 CTGGCTGCATTCTGAAAAAATGG - Intergenic
1114282655 14:21207910-21207932 CCCGGTTCCCTCTGAAAAAGAGG + Intergenic
1115571697 14:34672735-34672757 CTGGTTACCTTCTGAAAACCAGG - Intergenic
1118722365 14:68603570-68603592 CTGGCTTCCTTTTGAAAATAAGG + Intronic
1119006534 14:70935925-70935947 CTGGTTTCCATCTGAAATACTGG - Intronic
1119153472 14:72387238-72387260 CTGGTTTCCTTATAAAAAAAAGG + Intronic
1119686534 14:76637157-76637179 CTGGATTCCTTTTTAAAAAGAGG - Intergenic
1121429769 14:93878631-93878653 CTGGGTCCCTGGGGAAAAACAGG + Intergenic
1121697276 14:95924156-95924178 CTGGGATCCTCCTCAAAAGCGGG + Intergenic
1121965276 14:98297691-98297713 GTGGGTAGCTTCTGAAAAAGGGG + Intergenic
1202897266 14_GL000194v1_random:17374-17396 CAGGTTTCCATCTGAAAATCAGG + Intergenic
1124497320 15:30194299-30194321 CATGGTTCCTTCTGATAAAATGG + Intergenic
1124746254 15:32344348-32344370 CATGGTTCCTTCTGATAAAATGG - Intergenic
1125022053 15:34995738-34995760 CTGGTGTCCTTATGAAAAGCAGG + Intergenic
1128935777 15:71745389-71745411 CTGAGTTCATCCTGAAAGACAGG - Intronic
1129880101 15:79000874-79000896 TTGGGTTCCTTTTGAAAGCCTGG + Intronic
1129891696 15:79075853-79075875 CTGGTTCCTTTCTGACAAACAGG + Intronic
1129969870 15:79768813-79768835 CTGGGCTCCATCTGCAGAACAGG + Intergenic
1130886489 15:88096748-88096770 CTGGGGACCGTCTGAGAAACTGG - Intronic
1132137852 15:99361167-99361189 CCGGGTTCCTTCATAAAACCTGG - Intronic
1133599988 16:7329960-7329982 CTGGGTATGTTCTGAGAAACTGG + Intronic
1134515130 16:14880849-14880871 CTGGGAGCATTCAGAAAAACTGG - Intronic
1134702805 16:16279496-16279518 CTGGGAGCATTCAGAAAAACTGG - Intronic
1134964738 16:18432619-18432641 CTGGGAGCATTCAGAAAAACTGG + Intronic
1134969025 16:18515154-18515176 CTGGGAGCATTCAGAAAAACTGG + Intronic
1135389695 16:22080295-22080317 CTGGTTCCCTTCTGAAAATGGGG - Intronic
1136037500 16:27551022-27551044 TTGGGGTACTTCTCAAAAACAGG + Intronic
1138263449 16:55642807-55642829 CTGGCTTCCTTCTGTTGAACTGG + Intergenic
1139290798 16:65856114-65856136 CTGGGTCCCATCTGAGAAACAGG + Intergenic
1140131392 16:72165175-72165197 CTGACTTCCTCTTGAAAAACAGG - Intronic
1140208120 16:72949973-72949995 CTGGGTACCTTCTCAATGACAGG - Intronic
1141369764 16:83475959-83475981 CTGGGTTAATTCTGAACAATGGG - Intronic
1142909344 17:3073808-3073830 CTGGTTTACTTCTCATAAACTGG - Intergenic
1146528754 17:33590110-33590132 CTGGGTTCATTCAGGAAAAGAGG + Intronic
1148879917 17:50717994-50718016 CTGCTTTCCTTCTTAAAAAGAGG + Intergenic
1149481407 17:57006169-57006191 CTAGGTTCCTTCTGACCAAGGGG + Exonic
1149863289 17:60136314-60136336 CTGGGTCCCCTATGAGAAACAGG + Intergenic
1152486614 17:80598666-80598688 CTGTGATCCTGCTGACAAACTGG + Intronic
1152898059 17:82925026-82925048 CAGGCTTCCTTCTGAAAGGCCGG + Exonic
1153995018 18:10433281-10433303 GTGGTCTCCTTCTGAAAAAGAGG + Intergenic
1156829676 18:41476549-41476571 CTGGTTTCCTTTTGAAAGAGAGG - Intergenic
1156961764 18:43040524-43040546 CTGAGTTCTTTATGAAAAATTGG + Intronic
1161155276 19:2729325-2729347 CTGGGTTCCTCCTCAAAAGCGGG + Intronic
1161981987 19:7634746-7634768 CTGTGCTCCCTCTGAAAACCAGG + Intronic
1162291830 19:9786033-9786055 CTCAGTTCCTTCTGAAACCCTGG - Intronic
1162493923 19:11012486-11012508 CTGGGAGCTTTCTGAAATACAGG - Intronic
1163054965 19:14711176-14711198 CTGCTTTCCTTCTGAAAGTCTGG - Intronic
1164583570 19:29450485-29450507 CTGGGTTTATTCTGTAAAATGGG + Intergenic
1164814235 19:31182158-31182180 CTGGGTTCTTTCTCCAAATCTGG - Intergenic
1165420207 19:35718481-35718503 CAGGGTTCCTTCGGAGAGACGGG + Intronic
1166342059 19:42144043-42144065 CTGGGATCCTTCTAAAAGACAGG - Intronic
1166747713 19:45149584-45149606 CTGGGACCCTTCAGAAAATCAGG - Intronic
1167800671 19:51739333-51739355 CTGGTGTCCTTATGAAAAAAGGG - Intergenic
1168497856 19:56869289-56869311 CTGGGGTCCTTATGAAAAGGAGG - Intergenic
925664232 2:6236422-6236444 CAGGGTTCCGTCTGAGACACAGG + Intergenic
926616887 2:15004939-15004961 CTGGATTCCTTAGGAAAAGCTGG + Intergenic
926745952 2:16158575-16158597 CTGGGTGGCTTATGAACAACAGG - Intergenic
927179577 2:20435192-20435214 CTGCCTTCCTTCTGAAAGTCTGG + Intergenic
927482988 2:23468968-23468990 CTGGGGCCCTCCTGGAAAACCGG + Intronic
928253988 2:29706240-29706262 CTGGGTTCCTGCTGACCAGCTGG - Intronic
930376039 2:50568000-50568022 CTCAGTTTCTTCTGAAAAATGGG - Intronic
931704276 2:64934222-64934244 CTGGGTTGCTGCTGAAAACAAGG + Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933224794 2:79735276-79735298 TTGAGTTTCTTCTGAAGAACAGG + Intronic
934862927 2:97779486-97779508 CTGGGTTCCAGTAGAAAAACTGG + Intronic
937721417 2:125101066-125101088 GTGACTTCCTTTTGAAAAACAGG - Intergenic
938684879 2:133728592-133728614 CTGGGTACTCTCTGTAAAACAGG - Intergenic
938961941 2:136351995-136352017 CTGGGTTCCTTGTTAAAGAGGGG - Intergenic
940106432 2:150106176-150106198 CTGGCTTCCTTCTTGAAATCAGG - Intergenic
942835382 2:180289622-180289644 ATGGGAAACTTCTGAAAAACAGG + Intergenic
943552459 2:189357409-189357431 CTAGATTCCTCCTGAAAAAAAGG - Intergenic
947103022 2:226641578-226641600 CTGATTTCCATCTGGAAAACAGG + Intergenic
1170173758 20:13444199-13444221 CAGAGTTCCTTTTGCAAAACCGG + Intronic
1170231797 20:14055956-14055978 CTGGGGTTCTTATTAAAAACTGG - Intronic
1170765687 20:19288467-19288489 CTGGAATCTTTCTGAAACACAGG + Intronic
1173410897 20:42808652-42808674 CAAGGTTCCCTCTAAAAAACAGG + Intronic
1173943260 20:46930150-46930172 CTGTGGTCCTCCTGAAGAACAGG + Intronic
1175200744 20:57275631-57275653 ATGGGTTGCTTCTGATAGACGGG - Intergenic
1175340751 20:58227848-58227870 CTGGGTTCCTTATGAAGACATGG + Intronic
1175714597 20:61247067-61247089 CTGGGTTCTCTCTGCAAACCAGG - Intergenic
1176616950 21:9033363-9033385 CAGGTTTCCATCTGAAAATCAGG + Intergenic
1177197967 21:17922946-17922968 ATTGGTTCCTTCTGGAAAAGTGG + Intronic
1177355045 21:19997052-19997074 CTAGATCCCTTCTGGAAAACAGG - Intergenic
1181441214 22:22936021-22936043 CTGGGGTCCTGCTGACAATCAGG - Intergenic
1182741363 22:32570304-32570326 CTGGCTCCCTTGTGAAATACTGG + Intronic
949146555 3:708168-708190 CTGGGTTCCTTCTAAAGTAATGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951519970 3:23602253-23602275 CTGGGTTCCTTTCTACAAACTGG + Intergenic
952925555 3:38316927-38316949 CTGGGTTTTTTATGAAAACCAGG - Intronic
955132991 3:56189047-56189069 CTGGTTTCCTCCTGAAAACTGGG - Intronic
955252780 3:57301170-57301192 CTGGGATCCTCTTGAATAACTGG - Intronic
955483039 3:59408602-59408624 CAGGGATCCCTCTGAAAAATAGG - Intergenic
957244402 3:77699800-77699822 CTGGATTCCTTTAGAAGAACTGG + Intergenic
960482993 3:118215908-118215930 CTGGATTTCATCTTAAAAACAGG - Intergenic
961228615 3:125278972-125278994 CTGGTTTCCTTCTGACATTCTGG + Intronic
962279193 3:134037449-134037471 CTGAGTTCCTTCTCCAGAACTGG - Intronic
962493049 3:135911954-135911976 CAGGGATCCTTGAGAAAAACAGG - Intergenic
964668505 3:159199963-159199985 CAGTTTTCCTTCTGAAAAATAGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966073001 3:175902579-175902601 GTGCGTTTCTTCTGAAAACCTGG - Intergenic
966801340 3:183767110-183767132 CTACCTTCCTTCTGGAAAACAGG - Intronic
966842923 3:184104193-184104215 CTGGGTTCCAGCTGATAAATGGG - Exonic
968177261 3:196561748-196561770 GTGGGTTCCATATGAAAGACTGG - Intronic
969038366 4:4274324-4274346 CTGGGATTCATCTGAAAACCGGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
970905588 4:21212557-21212579 CTGGGTAGCTTCTAAACAACAGG + Intronic
972092847 4:35310474-35310496 CTGTCTTCCTTCATAAAAACAGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
975435834 4:74350226-74350248 CTGGGATCCTACTGATAACCTGG - Intergenic
976715461 4:88118571-88118593 CTGGGTTGCTTCTTAAAATATGG - Intronic
977768519 4:100829387-100829409 CTACTTTCCTTCTGAAAATCTGG - Intronic
978649137 4:110979486-110979508 GTGTGTTCCTTTTGAACAACTGG + Intergenic
979313521 4:119231917-119231939 CTGTTTTCCTTCTGGAAATCTGG - Intronic
981982422 4:150810250-150810272 CTTGGTTCCTTTTGGAAAGCAGG + Intronic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
986984707 5:13487383-13487405 CTGGGTGTCTTCTAAATAACAGG - Intergenic
987033835 5:14000176-14000198 CTGGCGTCCTTCTGAAAAGAGGG + Intergenic
987734941 5:21828484-21828506 CTGGTTTTCTTCTGAGACACAGG + Intronic
997582516 5:135026733-135026755 CTTGGTTCCATCTGTAAAATAGG + Intergenic
999730943 5:154476414-154476436 CTTGGTTCCTGCTGAAAGAGCGG - Intronic
1001209627 5:169797960-169797982 CAGAGTACCTTCTGAAAAACAGG + Intronic
1002128439 5:177064490-177064512 CTTTGTTCCTTCTCAAATACAGG + Exonic
1003161392 6:3637415-3637437 CATGGTTCCATGTGAAAAACAGG + Intergenic
1009492296 6:64306395-64306417 CTGAGTTCCCTCTTAATAACAGG + Intronic
1011079293 6:83472059-83472081 GTGGGTTCCTTCAGAAACTCTGG + Intergenic
1011924994 6:92631694-92631716 CTGTGTTCCTTCTGAAGATGAGG + Intergenic
1014024388 6:116628173-116628195 GTGGGTTCCTGCTGAAATTCGGG - Exonic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1016949291 6:149565182-149565204 CTGGGTTCCATCTGCAAACTTGG - Intergenic
1017019849 6:150131217-150131239 ATGGAGTCTTTCTGAAAAACAGG - Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1022343288 7:29488151-29488173 CTGAGTTCCCTCTGAAAGGCTGG - Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1023762642 7:43480903-43480925 CAGGACTCCTTCTGAAAAAGTGG - Intronic
1024424183 7:49206830-49206852 CTGGATTTCTTCTGACACACTGG + Intergenic
1025697715 7:63788413-63788435 CTGTGTTTCTTCTTAAAGACAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026073645 7:67145447-67145469 CTGGTTTCATTTTTAAAAACTGG + Intronic
1026703241 7:72666729-72666751 CTGGTTTCATTTTTAAAAACTGG - Intronic
1027171860 7:75878474-75878496 GTGGGCTCCTTCAGAACAACTGG + Intronic
1033164032 7:139023353-139023375 CTGGCTTCTTTTTAAAAAACTGG + Intergenic
1033313762 7:140281320-140281342 CTGTGTTCCTTTTGAAAGCCTGG - Intergenic
1035624018 8:1058316-1058338 CTGGGTTCCTACAGAAATTCGGG - Intergenic
1037950638 8:23017020-23017042 CTGGGTTCCTTTCCAAAGACGGG - Intronic
1039442994 8:37608273-37608295 CTGGGTTCCATGTTAAAAAATGG + Intergenic
1039808726 8:41025991-41026013 CTCTGTTCCTTCTGATCAACAGG + Intergenic
1040526623 8:48231118-48231140 CTTGGTTCCTTCTCAAAAGATGG + Intergenic
1042138769 8:65658032-65658054 CTAGGTTCCTTATGAATCACTGG - Intronic
1042638612 8:70906697-70906719 CTGCATTCGTTCTGAAATACTGG + Intergenic
1043848075 8:85183916-85183938 CTGGGGTCCTTATGAGAAAGGGG + Intronic
1043869055 8:85410260-85410282 CTAGTTTCCTTATGAAAAAATGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044094210 8:88042311-88042333 CTGTGCTCCTTCTAAACAACAGG + Intronic
1044709884 8:95046866-95046888 CTGTTTTACATCTGAAAAACAGG - Intronic
1044913001 8:97081705-97081727 CTGGGGGCCTTCTGAAAACATGG - Intronic
1046910558 8:119621738-119621760 TTGGGTTCCTTTGGAAAAATGGG + Intronic
1048655018 8:136526466-136526488 CTGGTTTCCTTCTTTAAGACGGG - Intergenic
1049751431 8:144286130-144286152 CTGGGTGGCTTCTGATGAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053225330 9:36350165-36350187 TTGGGTGCCTTGTCAAAAACTGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056674453 9:88662574-88662596 CTTTGTTCATTCAGAAAAACAGG + Intergenic
1057486205 9:95486560-95486582 CTGGGGTGCTTCCGGAAAACAGG - Intronic
1057918423 9:99075522-99075544 CTGAATTCCTTCTGATAGACAGG + Intergenic
1060152299 9:121296441-121296463 CAGGGTTCCATCTGTAAAATGGG - Intronic
1061644664 9:131990980-131991002 CGGGGTTCTTGCTGAAAGACAGG + Intronic
1062657362 9:137611185-137611207 CTGTGTTCATGCTGAAAATCCGG - Intronic
1187537983 X:20161274-20161296 CTGGTTTCCTTCTGTGAAATGGG + Intronic
1187878401 X:23823540-23823562 CTGGCTTCCTTCTGTGAATCTGG - Intergenic
1194227453 X:91279020-91279042 TTGGGTTCCATGAGAAAAACAGG + Intergenic
1194767624 X:97860467-97860489 CTGGGTGCCTTCTGATGAATGGG + Intergenic
1196321426 X:114344886-114344908 ATGGGTTTCTTGAGAAAAACAGG + Intergenic
1196345781 X:114656060-114656082 TTTGGTGCCTTCTGTAAAACTGG + Intronic
1197716835 X:129715238-129715260 GTGGGTTCCTCCTGAAATGCAGG + Intergenic
1199374716 X:147094146-147094168 CTGGATTTCTTCCTAAAAACTGG - Intergenic
1199677669 X:150201372-150201394 CAGGTTTCCTTCTGAAAGACTGG - Intergenic
1199692324 X:150318017-150318039 CTGTGTTCCTCCTATAAAACAGG - Intergenic
1201864572 Y:18635819-18635841 TAGGGTTCCTTCTGAAAAGAGGG + Intergenic
1201868750 Y:18684559-18684581 TAGGGTTCCTTCTGAAAAGAGGG - Intergenic