ID: 1072427194

View in Genome Browser
Species Human (GRCh38)
Location 10:95339444-95339466
Sequence CCTTCCCTGCTGAACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072427188_1072427194 13 Left 1072427188 10:95339408-95339430 CCTGCATTGTTTATCACATCCTT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 1072427194 10:95339444-95339466 CCTTCCCTGCTGAACCTGGAGGG 0: 1
1: 0
2: 3
3: 23
4: 259
1072427190_1072427194 -6 Left 1072427190 10:95339427-95339449 CCTTAGCTCAGGAAAAACCTTCC 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1072427194 10:95339444-95339466 CCTTCCCTGCTGAACCTGGAGGG 0: 1
1: 0
2: 3
3: 23
4: 259
1072427187_1072427194 30 Left 1072427187 10:95339391-95339413 CCTGCATGCTTCAATGTCCTGCA 0: 1
1: 0
2: 1
3: 6
4: 155
Right 1072427194 10:95339444-95339466 CCTTCCCTGCTGAACCTGGAGGG 0: 1
1: 0
2: 3
3: 23
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072427194 Original CRISPR CCTTCCCTGCTGAACCTGGA GGG Intronic
900229795 1:1550866-1550888 CCCTCCCTGCTGGGCCTGGGAGG + Intronic
900420130 1:2552689-2552711 CTGTCCCTGCTGAACCTGGAAGG + Intergenic
900424300 1:2568969-2568991 CTGTCCCTGCTGAACCTGGAAGG - Intergenic
900429840 1:2596347-2596369 CTTTCCCAGCTGGACCTGCAGGG + Intronic
900940152 1:5793366-5793388 CCTTCCATGCGCTACCTGGAGGG - Intergenic
901144833 1:7057826-7057848 CCTTCCCTTCTGAGCTGGGATGG + Intronic
901493917 1:9610628-9610650 CCTGCCCGGCTCAACCTGAAGGG + Exonic
901951955 1:12756441-12756463 CTTTCCCTGCTGTTCCTGGAAGG - Intronic
902678078 1:18022964-18022986 TCTTCCCTGCTGCACCTCCAGGG + Intergenic
903954150 1:27013133-27013155 CCCTCCCTCCTGACCCTGGCGGG - Intergenic
903958008 1:27038435-27038457 CCTTCCCTGCTGTGCCTGCGTGG + Intergenic
904967734 1:34391795-34391817 CCTACCCTTCTGAGCCAGGAAGG - Intergenic
905292577 1:36932510-36932532 CTTTCACTTCTGAACCCGGAAGG - Intronic
905500388 1:38432027-38432049 CGTTCCCTGCAGTACCTGCAAGG + Intergenic
905932747 1:41801162-41801184 CCCTCTGTGCTGAGCCTGGAAGG + Intronic
907284673 1:53371948-53371970 CCTTCCTTGCTGGCCCTGGCTGG - Intergenic
908498928 1:64723473-64723495 CCTTCCTATCTTAACCTGGAGGG + Intergenic
909931515 1:81503945-81503967 CCTTCTCTGCTGAGCATGGTTGG + Intronic
910506148 1:87952029-87952051 CCTTCTCTGCTGAATCTAGCTGG - Intergenic
912748957 1:112269632-112269654 CCTTCCCTGCTCCACTTAGATGG - Intergenic
915311322 1:155007251-155007273 CCTGCCCTGCTGCCCCTGGCAGG + Intronic
916389855 1:164319871-164319893 TCCTCCCTCCTCAACCTGGAAGG - Intergenic
917780121 1:178385849-178385871 TCTTCCCTGTTAAACCTGCAAGG + Intronic
920045647 1:203130485-203130507 CCTTCCCTGGAAAACCTGGAGGG - Intronic
920632589 1:207667153-207667175 CTTTCGCTGCTTAACCTTGATGG + Intronic
921337429 1:214102309-214102331 CCTTCCTAGCTGAACATGGCTGG - Intergenic
922362266 1:224833972-224833994 CCTTCCCTGCTGAGACAGCATGG + Intergenic
922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG + Intergenic
1062860795 10:807657-807679 CCTGCCCTGGTGGAGCTGGAGGG - Exonic
1063297111 10:4817832-4817854 CAGTCCCTGCTGAAGGTGGATGG + Intronic
1064162916 10:12961046-12961068 CTTTCCCTTCGCAACCTGGATGG + Intronic
1064461651 10:15540467-15540489 CCTTCTCATCTCAACCTGGAGGG + Intronic
1066433914 10:35379287-35379309 CCTGCCCCCCTGGACCTGGATGG + Intronic
1066455475 10:35568280-35568302 CCTGCCCTGCTGAACCCCTAGGG - Intronic
1067090702 10:43264664-43264686 CCCTCCCTGCTGCCCCTTGACGG - Intronic
1068201684 10:53791586-53791608 TCTTCCCTGTTGACCCAGGATGG + Intergenic
1071492745 10:86147079-86147101 CCTTTGCTGCTGAATCTGGCAGG - Intronic
1072427194 10:95339444-95339466 CCTTCCCTGCTGAACCTGGAGGG + Intronic
1074972111 10:118547723-118547745 CCTTTCCTGCTGAACCCAGCTGG - Intergenic
1075074003 10:119338184-119338206 CCTTCTCTCCTGAGCCTGGTGGG + Intronic
1076112563 10:127872276-127872298 GCTTCCCGGGTGGACCTGGAGGG - Intergenic
1078355590 11:10629479-10629501 CCTTCCCTCCCGACCCTAGAGGG + Intronic
1079263285 11:18904969-18904991 CCATGCCTTCTGACCCTGGAGGG + Intergenic
1079357574 11:19742794-19742816 TCTGCACTGCTGTACCTGGAAGG + Intronic
1081812152 11:45920196-45920218 CCCTCCCTGCAGAACTGGGAAGG + Intergenic
1082797396 11:57387971-57387993 CCTTCCCTGCTGGACCATGATGG + Intronic
1082812098 11:57484593-57484615 CCTGCCCTCCTGGCCCTGGAAGG + Exonic
1082863164 11:57874275-57874297 CCTTCTTTGCTGAACATTGAGGG + Intergenic
1085417088 11:76326289-76326311 CCAACTCTGCTGAATCTGGAGGG + Intergenic
1087637593 11:100719943-100719965 CCTCCCCTGCTGAATGTGGCTGG + Intronic
1088876418 11:113940311-113940333 CCACCCCTGCTGACTCTGGAGGG - Intronic
1089606238 11:119643178-119643200 CCTTGCCTGATGCACCTGGAGGG + Intronic
1090353747 11:126124983-126125005 CCTTCTCAGATGAACCTGGAGGG + Intergenic
1091110754 11:132964060-132964082 CCTTCTGTGCTGAACCCAGAGGG + Intronic
1092160128 12:6311226-6311248 CCCTCCCCCCTAAACCTGGAGGG - Intronic
1092238057 12:6822005-6822027 TCTGCCCTGGAGAACCTGGAGGG + Intronic
1092288389 12:7143181-7143203 CAGTCCCTGCTCACCCTGGAGGG + Exonic
1092480741 12:8857178-8857200 ACAGCCCTGCAGAACCTGGATGG + Exonic
1093636814 12:21480602-21480624 CTTTGCCTGCTGGCCCTGGATGG + Intronic
1094829895 12:34295303-34295325 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1094830974 12:34300127-34300149 CCTTCCCAGCAGCACCTGCATGG + Intergenic
1094833617 12:34312051-34312073 CCTCCCCAGCAGAACCTGTATGG - Intergenic
1094837724 12:34329965-34329987 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1095830955 12:46586056-46586078 CCTGCCTTGCTGCAGCTGGATGG - Intergenic
1096521605 12:52187700-52187722 CCATCCCTACTGAACCTGTTTGG - Intronic
1096918378 12:55057712-55057734 CCTTCCCTGCCTGCCCTGGAGGG + Intergenic
1098141869 12:67457953-67457975 CCTTTCCTCCTGAGCCTGGGTGG + Intergenic
1100478930 12:94959452-94959474 CCATCCCTGCTGAACCTCAGGGG + Intronic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1102709533 12:114914070-114914092 TTTTCCCTGGGGAACCTGGATGG + Intergenic
1102760862 12:115383737-115383759 CCTTGCCTGCTTAACTTTGAAGG + Intergenic
1103275764 12:119710586-119710608 AACTCCCTGCTGAAACTGGAAGG - Exonic
1103926660 12:124427169-124427191 TCTTGCCTGCGGAACCTGGAAGG - Intronic
1104066247 12:125309616-125309638 TCTTCAGTGATGAACCTGGAGGG - Intronic
1104767787 12:131341614-131341636 CCCTCCCTGTGGAACCTGGCCGG + Intergenic
1104811932 12:131624468-131624490 CCCTCCCTGTGGAACCTGGCCGG - Intergenic
1113634781 13:111912147-111912169 CTTTCCCTGATGAACTTGGCAGG + Intergenic
1114484500 14:23054887-23054909 CCTTCCCTGCTGCTGCTGAATGG - Intronic
1115582373 14:34774071-34774093 CCTTCTCTGCTGAGTCTGGTTGG - Intronic
1118064910 14:62180249-62180271 CCTTGTCTTCTGAAGCTGGATGG + Intergenic
1118545792 14:66887043-66887065 TCTTCCCTGCTGAAACATGAGGG - Intronic
1119663235 14:76466026-76466048 CCTTGCCTGCAGAGCCAGGAGGG - Intronic
1122350595 14:101087728-101087750 ACTTACCTGCTGAACAAGGAGGG - Intergenic
1122768924 14:104088554-104088576 CCCTCCCTGCTGTGCCTGCAAGG - Intronic
1124589292 15:31039154-31039176 CCTTCCCTTCAGAACCGTGAAGG + Intronic
1128526952 15:68419044-68419066 CCTTCCCTTCTAAGCCTGCAGGG + Intronic
1128600330 15:68990495-68990517 GCATCCTTGCTGACCCTGGAGGG + Intronic
1128806709 15:70536460-70536482 TCTTGCCTGCTAAGCCTGGAAGG - Intergenic
1129873736 15:78958597-78958619 GCCTCCCTGCTGAGGCTGGAAGG + Intergenic
1130322610 15:82853511-82853533 CCTGCCCTGCCCGACCTGGAGGG - Intronic
1130922146 15:88356694-88356716 CCTTCCCCCTTGAACCTGGGTGG - Intergenic
1130986031 15:88845389-88845411 CCTTCCCTGCTGGGGCAGGAGGG - Intronic
1132976703 16:2714662-2714684 CTGGCCCTGCTGCACCTGGAGGG - Intronic
1133281957 16:4671674-4671696 GCTGCCCTGGGGAACCTGGATGG - Intronic
1135327053 16:21533173-21533195 CCTCCCATGCTGAATCAGGATGG + Intergenic
1135912231 16:26571930-26571952 CCTACCCTAGTGTACCTGGAAGG - Intergenic
1136337369 16:29619013-29619035 CCTCCCATGCTGAATCAGGATGG + Intergenic
1137441855 16:48504763-48504785 CCTGCCCTGCGGAAGCTGGTGGG + Intergenic
1138224931 16:55284962-55284984 CTTTCCCTTCTGAACCCTGAAGG - Intergenic
1142040171 16:87888357-87888379 CCTCCCATGCTGAATCAGGATGG + Intronic
1142997407 17:3769080-3769102 CCTTCCCTGCTCCCCCAGGAAGG + Intronic
1144835950 17:18156849-18156871 CCTTCCCTGATGAGTCAGGAAGG + Intronic
1146980897 17:37160589-37160611 CCTGCCCAGCTGAACTTTGATGG - Intronic
1147369130 17:39979817-39979839 CCTTCCCTGCAGAACCAGTGGGG + Intergenic
1148582291 17:48752394-48752416 CCTTCCCTTCAGAACCCTGAGGG - Intergenic
1148744941 17:49912885-49912907 CCATCCCTGCTCAACCTGGCGGG - Intergenic
1148840016 17:50489031-50489053 CCTACCTTGTTGAACCTGGAAGG + Intergenic
1151277854 17:73049405-73049427 CCTGCCCTGCTGCTCCTGGAAGG - Intronic
1151452849 17:74209796-74209818 CCTTCACTGCCAAACCTAGAGGG - Exonic
1151474698 17:74338954-74338976 GCTCCCCTGCTGACCCAGGAAGG + Intronic
1151668811 17:75560240-75560262 CCTACCCTGCTGAACGGGAAAGG - Intronic
1152852196 17:82643863-82643885 CCTTCCCTGCTCCACCTGCAAGG + Intronic
1157421497 18:47551148-47551170 CCTCCCCTACTGACCCTGGCAGG - Intergenic
1158429884 18:57375762-57375784 CCTTCTCTGCTGCCCCTGTATGG + Intergenic
1160187803 18:76688903-76688925 CCATCCCTGCTGCAGGTGGACGG - Intergenic
1160868952 19:1268367-1268389 CCTCCCCTACTGAGCCTGGTTGG - Intronic
1161951136 19:7468843-7468865 CCTTCCCCGTTGAAGCTGGGAGG - Exonic
1162384649 19:10353725-10353747 CCTTCCCTCCCGACCTTGGAGGG - Intronic
1163680973 19:18682389-18682411 CCTTCACTGCTGAGTCTTGATGG + Intergenic
1166743132 19:45126182-45126204 CCTTCCCTGCAGAGCCTGTGAGG + Intronic
1167410655 19:49341858-49341880 CCTTCCCTGGTGAAGCTGACTGG - Intronic
1167834890 19:52060410-52060432 CATTCTCTGGTGAAACTGGAAGG + Intronic
1168115923 19:54221343-54221365 CCCTCCCTCCTGACCCTGCAGGG - Exonic
1168118906 19:54241091-54241113 CCCTCCCTCCTGACCCTGCAGGG - Exonic
1168133849 19:54337660-54337682 CCCTCCCTCCTGACCCTGCAGGG - Exonic
1168187537 19:54709569-54709591 CCCTCCCTCCTGACCCTGCAGGG + Intergenic
928203819 2:29269835-29269857 CCTTCACTGGTGCACTTGGAAGG - Intronic
928260400 2:29761450-29761472 CCTTCTCAGCTGAATCTTGAGGG + Intronic
928415848 2:31091032-31091054 CCTTCACTGCTGAAGGAGGAAGG - Intronic
929803693 2:45126397-45126419 CCTTCCTTGTTGAAAGTGGAAGG + Intergenic
933724873 2:85421000-85421022 CCTTCCTTGATGGGCCTGGAGGG - Intronic
933757194 2:85649049-85649071 TCTGCCCTGCTGAAGCTAGATGG - Exonic
933770193 2:85738853-85738875 CCTTCCCTGCTGACCTGTGATGG - Intergenic
934737854 2:96698979-96699001 CCCTCCCTGACAAACCTGGACGG + Intergenic
934855577 2:97727383-97727405 CCTGCCCTGCTGCATCTGGAGGG + Intronic
936086818 2:109474869-109474891 CCTTCCCTGCTGGCTCTGGAGGG - Intronic
936159138 2:110070863-110070885 CCTGCTCTCCAGAACCTGGAAGG - Intergenic
936185523 2:110300469-110300491 CCTGCTCTCCAGAACCTGGAAGG + Intergenic
936414532 2:112292635-112292657 CATTCCCTGATGAATGTGGAGGG - Intronic
937256684 2:120560844-120560866 CCATCACTGCTCAATCTGGAAGG + Intergenic
938384218 2:130853023-130853045 CATGCCCTGCTGACCCTCGATGG - Intronic
939096040 2:137834566-137834588 CTTCCCATGCTGCACCTGGACGG + Intergenic
939498857 2:142956258-142956280 CCTTCCCTTCTGATCATGTAAGG + Exonic
942206567 2:173625390-173625412 CATTCCCTTCTGAAGCTGGCGGG + Intergenic
942272386 2:174289666-174289688 CTATCCCTGATGAACATGGAAGG + Intergenic
943775366 2:191759758-191759780 TCTTCCCTTCTGACTCTGGAGGG + Intergenic
946188034 2:217992205-217992227 CCTTCCCAGCTGTAGCAGGAGGG + Intronic
946428052 2:219609980-219610002 CCTTCCCGGCTGACCTTGGAAGG + Intronic
946952214 2:224889309-224889331 CTTTCCCTGCTGAAAATGAAGGG - Intronic
946996703 2:225400652-225400674 TCTTCCCTGCTGGACCTGGAAGG + Exonic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
948501341 2:238397206-238397228 CCTTCCCTGCTCAATGGGGATGG - Intronic
948920817 2:241065066-241065088 CCTTCCCTGAGGAACAGGGAGGG + Intronic
1169677688 20:8172965-8172987 GCTTCCCTGTTGACACTGGATGG - Intronic
1170539123 20:17370662-17370684 CCTTCCCTACTGAACATGAGTGG + Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1171847955 20:30289295-30289317 CCTTCTCTCCACAACCTGGAGGG + Intergenic
1172209599 20:33187412-33187434 CCTTCCCTGCCATTCCTGGAGGG - Intergenic
1172426063 20:34856879-34856901 CCCTGCGTGCTGAGCCTGGAGGG + Exonic
1172767128 20:37356773-37356795 TCTGCCCTCTTGAACCTGGAGGG + Intronic
1172821990 20:37744629-37744651 TCTTCCCTGCTGAGCCAAGATGG - Intronic
1174090321 20:48041778-48041800 CCCTCCATGCTTACCCTGGAAGG - Intergenic
1174282899 20:49452300-49452322 GCTTCCGTGCTGACCTTGGATGG - Intronic
1174429398 20:50456753-50456775 CCTTCCTTGATGTCCCTGGATGG + Intergenic
1174841052 20:53901841-53901863 GCCTCCCTCCTGAACCTGCAAGG - Intergenic
1175266559 20:57706924-57706946 TCTCCCCTGCTGAGCCTGGCTGG - Intronic
1175669823 20:60892560-60892582 CCTTCTCTGCAGAACCAGTATGG + Intergenic
1176519748 21:7815710-7815732 CATTCCCTGCTCCATCTGGATGG + Intergenic
1176519782 21:7815855-7815877 CATTCCCTGCTGTGTCTGGACGG + Intergenic
1176519847 21:7816145-7816167 CATTCCCTGCTCCATCTGGACGG + Intergenic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1178653776 21:34445723-34445745 CATTCCCTGCTCCATCTGGATGG + Intergenic
1178653810 21:34445868-34445890 CATTCCCTGCTGTGTCTGGACGG + Intergenic
1178653875 21:34446158-34446180 CATTCCCTGCTCCATCTGGACGG + Intergenic
1178661987 21:34514611-34514633 CCTTCCCTGCTGTTCGTGAAAGG - Intronic
1180790663 22:18573915-18573937 CCTTCCCTCCTGAACTTTGGCGG + Intergenic
1181036155 22:20170648-20170670 GCTTCTCTGCTGAGGCTGGATGG - Intergenic
1181231074 22:21421399-21421421 CCTTCCCTCCTGAACTTTGGCGG - Intronic
1181247574 22:21513469-21513491 CCTTCCCTCCTGAACTTTGGCGG + Intergenic
1181790571 22:25262603-25262625 CGTTCTCTGCTGCACCTGGAAGG + Intergenic
1181826380 22:25519637-25519659 CATTCTCTGCTGCACCTGGAAGG + Intergenic
1181936587 22:26443089-26443111 CATCCTCTGCTGAACCTGGGGGG - Exonic
1183191779 22:36326252-36326274 CCTCCCCTTCTGAGGCTGGAAGG - Intronic
1183529036 22:38342559-38342581 CCTTCTCTGGTGCACCAGGAAGG - Intronic
1183640537 22:39090001-39090023 CCTTCCCTGCTGTCTCCGGATGG - Intergenic
1184355655 22:43977860-43977882 CCTTCCCTGCAGGAACTGGCAGG + Exonic
1185147234 22:49145222-49145244 CCTTCCCTCCTGTAGCTGCAGGG + Intergenic
1185297117 22:50059839-50059861 CCTTCCCAGCTGCTCCTAGAGGG - Exonic
952391396 3:32883906-32883928 ACTTCCCTTCTGAAGCTGGAAGG - Intronic
952907297 3:38149750-38149772 TCATTCCTACTGAACCTGGAGGG - Intergenic
953754926 3:45637769-45637791 CCTAACCTGCTGAGCCTTGATGG + Intronic
956131189 3:66055372-66055394 CCTTCCCTGCTGGACCAAGCTGG + Intergenic
961340493 3:126213911-126213933 CCTTCCCTTCTGTGCCTGGCTGG - Intergenic
961361045 3:126367354-126367376 CCTCCCCAGCTGAATCTGGCTGG + Intergenic
962629669 3:137263506-137263528 AATTGCCTGCTGAATCTGGATGG - Intergenic
963912582 3:150827213-150827235 ACTGCCCTGCTGAAGCTGTAAGG - Intergenic
965616040 3:170593575-170593597 CCTTCCCTGAGGATTCTGGAAGG - Intronic
967007767 3:185400292-185400314 CCTTCCCTGGTCATCCTGGATGG + Intronic
967275844 3:187773801-187773823 CCATCCCTGGTGTACCTGAAAGG - Intergenic
967283309 3:187843584-187843606 CCTTCTCTTCTGAACCTCTATGG + Intergenic
967284282 3:187853423-187853445 CCTTCCCTTCTGAATCTACAAGG + Intergenic
968913575 4:3487535-3487557 CCTTCCCTCCTGCTCCTGGTGGG - Intronic
968972021 4:3800934-3800956 CCTGCCCTGATGCACCTGCATGG - Intergenic
970060308 4:12026039-12026061 CCTTAGCTGCTTAACCTGGCAGG + Intergenic
977928863 4:102730335-102730357 CCTTCCCTGTGCCACCTGGAGGG + Intronic
978320939 4:107494971-107494993 CCTTCCCAGATAAACATGGATGG + Intergenic
979502092 4:121452456-121452478 CCCTCCCTGGTTAACCTGGCTGG - Intergenic
980790439 4:137613314-137613336 CCATCCCTGCGGATCCTGCAGGG + Intergenic
982235599 4:153248954-153248976 CTTTGCCTGCTAACCCTGGAGGG - Intronic
983380242 4:166982097-166982119 CCCGCCCTGCTGAACCAGCAGGG + Intronic
983619506 4:169745310-169745332 CCTTCCCTGATGACCTGGGATGG - Intronic
984821511 4:183886589-183886611 CCTTTCATTCTGCACCTGGACGG - Intronic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
985965814 5:3338255-3338277 CCCTCACTGCTGTACATGGAAGG - Intergenic
994077504 5:95669916-95669938 TCATTCCTGCAGAACCTGGAGGG + Intronic
994187037 5:96826595-96826617 CCATACTGGCTGAACCTGGATGG - Intronic
994825658 5:104710171-104710193 CCCTTCCTGCTGGACCTGCAAGG + Intergenic
995998765 5:118332852-118332874 CCTTCCCTGCCCAACCTTGTGGG + Intergenic
997211217 5:132078026-132078048 CCATCCCTGGTCAACCTGGCCGG - Intergenic
997732348 5:136191021-136191043 CCTGCCCTGGAGAACCTGGCAGG - Intergenic
998004238 5:138646778-138646800 CCTCCTCTGCTGGACCTGGCGGG + Intronic
999828582 5:155297870-155297892 ACTTCCTTACTTAACCTGGAGGG - Intergenic
1001554267 5:172625473-172625495 CCTTCTCTGATCACCCTGGATGG + Intergenic
1002484031 5:179522815-179522837 CCTGCCCTGCTGTCCCTAGAGGG - Intergenic
1002500532 5:179644666-179644688 CCTGCCCTGCTGTCCCTAGAGGG + Intronic
1003113838 6:3270313-3270335 CCTCCCCTGCTGAGCCCGGCGGG + Exonic
1003673082 6:8177999-8178021 CCTTCACTGCTCAGCCTGGCAGG + Intergenic
1004518264 6:16339097-16339119 CCTTCCCTGCGGGATGTGGAAGG - Intronic
1006509757 6:34515535-34515557 GCCTCCCTGCTGGCCCTGGATGG + Intronic
1006803081 6:36771750-36771772 CCTCCCCTGCCTACCCTGGAGGG + Intronic
1007591014 6:43021008-43021030 CCTTCCCAGCAGAACCTGGCTGG - Exonic
1007740706 6:44008017-44008039 ACTTCCCTGCTGTAACTGCAGGG - Intergenic
1015377797 6:132530410-132530432 CCTTCCCTGCAGAACCCAGGAGG - Intergenic
1016922196 6:149306788-149306810 CCTGCCCTGCTGAACCCAGCAGG - Intronic
1017531408 6:155296085-155296107 CCACCCCTGCTTACCCTGGAGGG + Intronic
1018964398 6:168473312-168473334 CAGTCCCTGCTGTGCCTGGAGGG - Intronic
1019156477 6:170042312-170042334 CTTTCCCTTCTGAATCTGCAAGG - Intergenic
1019260775 7:80725-80747 CCATCCCTTCTGAACCTGCGGGG - Intergenic
1019911219 7:4101571-4101593 CCTCCCCTGCTGCACATGGTGGG - Intronic
1020150775 7:5680249-5680271 ACTTCCCTGTTGGACCTTGAAGG - Intronic
1023538554 7:41240098-41240120 CCTGTCCTGCTGAGCGTGGATGG - Intergenic
1023881181 7:44322629-44322651 CCTTCCCTGCTCAGCCTGGCAGG - Intronic
1024257057 7:47547144-47547166 CCCTCCCTCCTCACCCTGGAGGG - Intronic
1030004243 7:105099822-105099844 CTTTACCTGATGAACCTGGTTGG - Intronic
1032275086 7:130447301-130447323 CCTCCCCTGGTGATCCTGGGAGG - Intergenic
1032478552 7:132228456-132228478 CCTTCCCAGTTGCACCCGGAAGG - Exonic
1033047910 7:137979307-137979329 CCTGCCATCCTGACCCTGGAGGG - Intronic
1035572679 8:683409-683431 CCCTCACGGCTGACCCTGGAGGG - Intronic
1036162519 8:6402881-6402903 CCTTGCAAGCTGAAGCTGGATGG + Intergenic
1036642234 8:10591753-10591775 CCTGCCCTCCTGCACATGGAGGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038776092 8:30532002-30532024 ATTTCCCTGGTGAAGCTGGAGGG + Intronic
1039659142 8:39444572-39444594 CCTTCCTTGCTGAGCATGGAAGG - Intergenic
1039971501 8:42324893-42324915 CCTTCCCTGCTGACCATGCCTGG - Intronic
1040436857 8:47399359-47399381 CCTTCCCAGCTGTCCGTGGATGG - Intronic
1047766119 8:127991520-127991542 CATGCCCTGCTGCACCTGGAGGG + Intergenic
1048272372 8:133039855-133039877 CCAGCCCTGCTGAAACTGGGGGG - Intronic
1048353017 8:133631176-133631198 CCTACCATGCTGACCTTGGATGG + Intergenic
1049338701 8:142100442-142100464 TCTCCCCTGGAGAACCTGGAAGG - Intergenic
1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG + Intronic
1053786090 9:41653945-41653967 CCTTCTCTCCAAAACCTGGAGGG + Intergenic
1054174807 9:61867886-61867908 CCTTCTCTCCAAAACCTGGAGGG + Intergenic
1054449663 9:65396939-65396961 CCTTCTCTCCAAAACCTGGAGGG + Intergenic
1054662733 9:67712907-67712929 CCTTCTCTCCAAAACCTGGAGGG - Intergenic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1056841221 9:89999468-89999490 CCCTACCTGCTAAACCTGCATGG - Intergenic
1057772331 9:97979937-97979959 TCTTCCCTGCTGCACCAGGAAGG + Intergenic
1057801902 9:98195914-98195936 CCTTCCCTGCTCTTTCTGGAGGG - Intergenic
1059383132 9:113943983-113944005 CCTTCCTTACTAAATCTGGATGG + Intronic
1061225924 9:129280971-129280993 GCTGCTCTGCTGACCCTGGAAGG + Intergenic
1061545031 9:131299512-131299534 CCTTTCCTGCTGCCCCTGCAGGG - Intronic
1061591030 9:131597658-131597680 CCTTGCCTGCAGAACCTCGTTGG - Intronic
1061747948 9:132753722-132753744 CCTTCCCTAGAGAACATGGAGGG - Intronic
1062112801 9:134791231-134791253 CGTTCACTGCTGCACCTGGCTGG + Intronic
1186473497 X:9839002-9839024 CCTTCCCTGTCGCACGTGGAAGG + Intronic
1186830706 X:13387316-13387338 TCTTCCCTGCTGAGTCTGAAGGG - Intergenic
1187061404 X:15790454-15790476 CCTTTCCTGCCAGACCTGGAGGG + Exonic
1187272685 X:17793017-17793039 CCTTCCCTGGACAGCCTGGAGGG + Intergenic
1189586584 X:42468055-42468077 CCTTCCCTTTTTATCCTGGAGGG - Intergenic
1192205081 X:69090252-69090274 CCTTCCCAGCTATGCCTGGAGGG - Intergenic
1192844504 X:74891888-74891910 CTTTCACAGCTCAACCTGGAGGG + Intronic
1198160759 X:134005632-134005654 CCTTTCCAACTGATCCTGGATGG - Intergenic
1199567429 X:149230237-149230259 CCTTCCTTGGGGAACTTGGAAGG + Intergenic
1200442704 Y:3230864-3230886 CATGCACGGCTGAACCTGGAGGG + Intergenic
1200697434 Y:6373453-6373475 CCTTCCCTGATGCACCTCCATGG + Intergenic
1201036679 Y:9791246-9791268 CCTTCCCTGATGCACCTCCATGG - Intergenic