ID: 1072428211

View in Genome Browser
Species Human (GRCh38)
Location 10:95348125-95348147
Sequence GTGGCTTTAACTAGATTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072428211_1072428214 15 Left 1072428211 10:95348125-95348147 CCTTATAATCTAGTTAAAGCCAC No data
Right 1072428214 10:95348163-95348185 GTGTTTGTGTCTGTAACCAAAGG No data
1072428211_1072428215 16 Left 1072428211 10:95348125-95348147 CCTTATAATCTAGTTAAAGCCAC No data
Right 1072428215 10:95348164-95348186 TGTTTGTGTCTGTAACCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072428211 Original CRISPR GTGGCTTTAACTAGATTATA AGG (reversed) Intronic