ID: 1072428984

View in Genome Browser
Species Human (GRCh38)
Location 10:95354658-95354680
Sequence ATTTATAAGCTAGTGCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072428980_1072428984 6 Left 1072428980 10:95354629-95354651 CCCATGCAGCAGTGCTGGCTGGA 0: 1
1: 0
2: 3
3: 23
4: 266
Right 1072428984 10:95354658-95354680 ATTTATAAGCTAGTGCCTGTGGG No data
1072428981_1072428984 5 Left 1072428981 10:95354630-95354652 CCATGCAGCAGTGCTGGCTGGAC No data
Right 1072428984 10:95354658-95354680 ATTTATAAGCTAGTGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072428984 Original CRISPR ATTTATAAGCTAGTGCCTGT GGG Intronic
No off target data available for this crispr