ID: 1072430748

View in Genome Browser
Species Human (GRCh38)
Location 10:95368814-95368836
Sequence CAGCCAAAAGGGCTGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 362}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072430748 Original CRISPR CAGCCAAAAGGGCTGGAGGA TGG (reversed) Intronic
900192683 1:1358162-1358184 CAGCAAGAGGGGCTGCAGGAGGG + Intronic
901131190 1:6963167-6963189 GAGCCAAAAGAGATGGAGGCTGG - Intronic
901131249 1:6963321-6963343 GGGCCAAAAGGGATGGAGGGCGG - Intronic
901787777 1:11636074-11636096 CTGCCAACCAGGCTGGAGGATGG - Intergenic
902388408 1:16088937-16088959 AAGCCAACAGGGCAGGAGGAGGG + Intergenic
902502198 1:16918472-16918494 CGGCCCTAAGGGTTGGAGGAAGG - Intronic
902733789 1:18386769-18386791 CAGACAATGGGGCTGGAGGAAGG + Intergenic
903426194 1:23256233-23256255 GAGAAAAAAGGGCTGGGGGAAGG - Intergenic
904257824 1:29267565-29267587 CAGCACAAAGGCCTGGAGGCTGG + Intronic
904422232 1:30401727-30401749 CAGGCAAAAGGGCTTGTGCAGGG + Intergenic
904496331 1:30888883-30888905 CAGACAAAAAGGCTGGAAGAAGG + Intronic
905887210 1:41497790-41497812 CAGCAAACAGGGCTGGAGCATGG + Intergenic
906124526 1:43419550-43419572 CAGACAGAAGGGCTTAAGGAAGG + Intronic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
912515713 1:110215447-110215469 CAGACAAGAGGCCTGGAGAATGG + Intronic
913069954 1:115289857-115289879 GAACCAAAAGGGCTGGATGGAGG - Intronic
913242278 1:116839411-116839433 CAGTCAAAAGACCAGGAGGATGG + Intergenic
914200529 1:145480710-145480732 CATCTCAAAGGGATGGAGGAAGG - Intergenic
914479643 1:148053837-148053859 CATCTCAAAGGGATGGAGGAAGG - Intergenic
914871098 1:151474710-151474732 CTGGTAAAAGGGCTGCAGGAGGG - Intergenic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
916652116 1:166842320-166842342 TAACCAGAAGGGCTGGAGGAGGG + Intronic
917031590 1:170698924-170698946 CAGCCAAAAGGCCTTGCTGAGGG - Intronic
917245883 1:172999667-172999689 CAGCCAAAAAGGCTGAATGCTGG - Intergenic
919918509 1:202153918-202153940 CATCCAGTAGGGGTGGAGGATGG - Intronic
919921659 1:202169770-202169792 GAGACACAGGGGCTGGAGGAAGG - Intergenic
920160755 1:203996212-203996234 CAGCCAAAAGCGCTGCTGGATGG + Intergenic
920190100 1:204188287-204188309 CACCCAGAAAGGCTGGAGGGAGG + Intergenic
920282415 1:204854089-204854111 CAGGCAAAAAGGCTGGTGGGTGG - Intronic
920999284 1:211026425-211026447 CAGCCAAAAGGAGTGGAAAATGG + Intronic
921063922 1:211609526-211609548 CAGGCAGAGGGGCTGAAGGAAGG - Intergenic
921179677 1:212622154-212622176 AAGCCAAAGGGGCAGGTGGAAGG - Intergenic
922533089 1:226359347-226359369 CAGGCACAAAGGCGGGAGGAGGG + Intergenic
922988610 1:229886210-229886232 CCACCAAAAGGGCAGGAGGAGGG - Intergenic
923537434 1:234863875-234863897 CTGCCAAATGGGCTGGGTGAAGG - Intergenic
1062916269 10:1243160-1243182 CAGCCGAAGGGCCTGGATGATGG - Intronic
1063208636 10:3858122-3858144 CCGACAAAAGGGCTTGAGGGAGG + Intergenic
1063909100 10:10811579-10811601 CATCTCAAAGGGATGGAGGAAGG + Intergenic
1064196463 10:13247687-13247709 CAACCAAAAGAGCTGGAGAATGG + Intergenic
1065258805 10:23903151-23903173 AAACCTAAAGGGATGGAGGAGGG - Intronic
1067146055 10:43694728-43694750 CAAACAGAGGGGCTGGAGGAGGG + Intergenic
1067297569 10:44983601-44983623 CTGCCAAGAGGCCTGGAGGTTGG + Intronic
1067659727 10:48225274-48225296 CAGCCAAAAGGCCATGAGGGAGG + Intronic
1067804672 10:49384564-49384586 CAGCCAGAAGGGCTTAGGGAAGG + Intronic
1068719075 10:60222166-60222188 TAGCCAAAATTGCTGCAGGAGGG + Intronic
1069628930 10:69885863-69885885 CAACCAAAAGGGCACGAGGGAGG - Intronic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1070758398 10:79007788-79007810 AAGCCAGAAGGGCTGGAGCAGGG - Intergenic
1072430748 10:95368814-95368836 CAGCCAAAAGGGCTGGAGGATGG - Intronic
1073065987 10:100759476-100759498 CAGCCAAAAGGGAGGGAGGCAGG + Intronic
1073152481 10:101321495-101321517 CCTCCAAAAGGCCTGGCGGAAGG + Intergenic
1073176439 10:101560284-101560306 CAGGCAGAGGGGCGGGAGGAAGG - Intergenic
1073479687 10:103778716-103778738 AAGCAGAAAGGGCTGGAGGAGGG - Intronic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076273439 10:129176194-129176216 GAGCCCACTGGGCTGGAGGATGG + Intergenic
1076541964 10:131220305-131220327 AAGCCAAGAGCCCTGGAGGATGG - Intronic
1077971570 11:7197802-7197824 CATGCAAAAGCCCTGGAGGAAGG - Intergenic
1078065991 11:8080101-8080123 CAGCCAAGGGGGCTGAGGGAGGG - Intronic
1078898790 11:15622256-15622278 CTGCCACAAGGCATGGAGGAAGG + Intergenic
1079628169 11:22641118-22641140 CAGTCGGAAGGACTGGAGGAGGG + Intronic
1080429132 11:32182574-32182596 CAACCATCAGGGCGGGAGGAAGG - Intergenic
1081599830 11:44485350-44485372 CAGCCATTAGGGCTGGAGTGGGG - Intergenic
1081718560 11:45268782-45268804 AAGCCAGTGGGGCTGGAGGAAGG + Intronic
1083052619 11:59790744-59790766 GAGCCAAAAGGGCTGGACTCTGG - Intronic
1083336644 11:61925691-61925713 CAGGTAAAAGGCCTGGAGGTGGG + Intergenic
1083993999 11:66263257-66263279 CAGGCACCAAGGCTGGAGGAGGG + Intronic
1084091268 11:66880643-66880665 CAGCCAGAAGGGCTGCAGACTGG - Intronic
1084268431 11:68016740-68016762 GAGCCCAATGGGCTGGGGGAAGG - Intronic
1084453610 11:69254588-69254610 CAGCCAAAGGGGAATGAGGAGGG + Intergenic
1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG + Intronic
1084767459 11:71322051-71322073 CAGCACAAAGGGCGGAAGGATGG - Intergenic
1085750651 11:79158080-79158102 CAGCCCAGAGTGCAGGAGGAGGG - Intronic
1087475209 11:98625698-98625720 CAAACAAAAAGACTGGAGGAAGG + Intergenic
1088807653 11:113366900-113366922 CCACCAGATGGGCTGGAGGAGGG - Intronic
1089290242 11:117433290-117433312 CAGCCATAAGGGGTTGGGGAAGG + Intronic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1089763529 11:120746484-120746506 CAGAAAAGGGGGCTGGAGGAAGG - Intronic
1092006385 12:5073977-5073999 CATCCAAAATGGCTGAAGGGTGG - Intergenic
1092039403 12:5370715-5370737 CAGAGAAAAGGGCTGCTGGAGGG - Intergenic
1092070748 12:5629536-5629558 CAGCAAATAGGGCTGCAGCATGG - Intronic
1092227348 12:6756427-6756449 AAGACAAGAGGGATGGAGGAAGG - Intronic
1094414423 12:30202001-30202023 CACCCAGAGGGGCTGGCGGAAGG - Intergenic
1095112298 12:38310936-38310958 CAGCCAAAGATCCTGGAGGAGGG - Intergenic
1095821128 12:46479647-46479669 CATCCAAAAGGTTGGGAGGATGG - Intergenic
1097261574 12:57723489-57723511 CAGCCAGCAGGGCTGCAGGGAGG + Intergenic
1098785973 12:74756290-74756312 CAGAGAAAAGGGTGGGAGGAGGG - Intergenic
1100113386 12:91272627-91272649 CTGCCAACAGGGCTGGGAGATGG + Intergenic
1101395420 12:104342762-104342784 CAGCCAAAAGGTCTAAAGCAGGG + Intronic
1101557190 12:105821440-105821462 CAGCCTAGAGGAGTGGAGGAAGG - Intergenic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1102429770 12:112874112-112874134 CAGCCAAAAGTGCTGGATTCAGG + Intronic
1102525424 12:113509178-113509200 CAGCCAAAATGACAGAAGGATGG - Intergenic
1102642614 12:114380177-114380199 GAGCCAAAGGGGCTGGAGCTGGG - Intronic
1103155469 12:118680835-118680857 CTGACAAAATGACTGGAGGAGGG + Intergenic
1105437289 13:20390175-20390197 CAGCCAGAGTGGCTGGAGAAGGG + Intergenic
1105744698 13:23366320-23366342 CATCCCAAAGGGCTGGAGTGTGG + Intronic
1105758802 13:23494416-23494438 CAGCAGACAGGGCTGGAGAAAGG - Intergenic
1106409348 13:29500131-29500153 CAGGCAGAAAGCCTGGAGGATGG - Intronic
1106943013 13:34797567-34797589 CAGCTAGAAGTGCTGGAGTAGGG - Intergenic
1108081220 13:46738211-46738233 CAGCTCAGAGTGCTGGAGGAAGG + Intronic
1109934176 13:69259502-69259524 CAGCCCCAAGGGCTGCAGGTTGG - Intergenic
1110573914 13:77034893-77034915 CAACCACAGGGGCTGGAGGCAGG + Intergenic
1110862608 13:80359520-80359542 CAGACAAAGGGGCGGGATGATGG + Intergenic
1112869730 13:103955348-103955370 AAGGCAAAAGGGCCGGTGGAAGG - Intergenic
1113650052 13:112028291-112028313 CAGCCAGAAGGGAGGGAGGGTGG + Intergenic
1113740935 13:112711972-112711994 CAGACAACAGGGCTGGGAGAAGG - Intronic
1114211850 14:20622708-20622730 CAGCCAAAGGGGCTGGCGACGGG + Intergenic
1114642387 14:24232331-24232353 CAGGCAAGAGTGCTGGAGGGCGG - Exonic
1114776205 14:25484800-25484822 CAGCTAAAATGGTTTGAGGATGG - Intergenic
1115300246 14:31877256-31877278 CAGCAAAAAGTGCTGAAGAAAGG - Intergenic
1119224017 14:72930100-72930122 CAGCCAAAAGGGGGGTAGGAGGG + Intronic
1121277717 14:92679188-92679210 CTGACAAAAGGGCTGGATGCAGG - Intronic
1122061443 14:99139183-99139205 CTGCCCAAAAGCCTGGAGGAGGG + Intergenic
1122969031 14:105144996-105145018 CAGCCACAAGGGCTGTGGCACGG - Exonic
1124373732 15:29117524-29117546 CAGCCAAGGGGGCGGGAGGCAGG - Exonic
1125874981 15:43136033-43136055 CAGAAAAAAGGACTGGGGGATGG - Intronic
1126324538 15:47462488-47462510 TATTCAAAAGGGCTGTAGGAAGG - Intronic
1126506497 15:49410149-49410171 AAGCCTAAAGGGCTGGAGAGTGG - Intronic
1128528091 15:68426033-68426055 CAGCAACAAGGGCTGGGGTAGGG + Intronic
1128678809 15:69631398-69631420 CAGGCAAAAGGGCCAGAGGCAGG - Intergenic
1128716699 15:69913869-69913891 CAGCCGACTGGGCTGGAGGTCGG - Intergenic
1130230272 15:82091618-82091640 CCCCCAAAAGGGGTGGGGGAGGG + Intergenic
1130486009 15:84398913-84398935 CAGCCAAAGAGGCTGCTGGACGG - Intergenic
1131102666 15:89705371-89705393 CATTCAAGAGGGGTGGAGGAAGG + Intronic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1132764395 16:1526895-1526917 CTGCCAAACGGGCATGAGGAGGG + Intronic
1132951014 16:2562509-2562531 CAGCCGAAGGAGCTGCAGGATGG - Intronic
1132963335 16:2637661-2637683 CAGCCGAAGGAGCTGCAGGATGG + Intergenic
1133523494 16:6581430-6581452 CAGCCAACACAGCTGGGGGAAGG - Intronic
1133716892 16:8458565-8458587 CTGCCAGAAGGGAAGGAGGATGG + Intergenic
1134071904 16:11265473-11265495 CAGACAAAAGGACTGGGGAATGG - Intronic
1135327843 16:21538616-21538638 CGGCCTAAAGGTCTGGAGGGTGG + Intergenic
1135349720 16:21718437-21718459 CAGGCAAAAGGAATGGACGATGG - Intronic
1135757054 16:25107157-25107179 CGGCCAAGAGGGCGGGTGGACGG - Intergenic
1135783514 16:25327128-25327150 CAGGCAAAAGGGGTGAATGATGG + Intergenic
1135784051 16:25332068-25332090 CAGGCAAAAGAGCTTGAGCAGGG - Intergenic
1135887271 16:26321686-26321708 CAGCCAGAAGGGAGGGAAGAAGG - Intergenic
1136081319 16:27854251-27854273 AAGGCAAAAGGGGAGGAGGAGGG + Intronic
1136338196 16:29624641-29624663 CGGCCTAAAGGTCTGGAGGGTGG + Intergenic
1136499820 16:30664600-30664622 CAGACAGCAGGGCTTGAGGAGGG + Intronic
1137365951 16:47859560-47859582 CACCCACAAGGGCTGCATGATGG + Intergenic
1137716352 16:50600764-50600786 CAGGCCTGAGGGCTGGAGGAAGG + Intronic
1138098187 16:54230154-54230176 CAGCCACGTGGGCTGGGGGAAGG + Intergenic
1138263962 16:55646005-55646027 AAGCTAAAATGGCTGGGGGACGG + Intergenic
1139599059 16:67975803-67975825 CAGCCACAAGGCCTGGAACAAGG + Exonic
1139665394 16:68451567-68451589 CAGCTAATAAGGCTGGAGGTGGG + Intergenic
1139910041 16:70392095-70392117 CAGCCACAGGCGCTGGAGGCAGG - Intronic
1140250099 16:73287957-73287979 CAGCAAGAAGGCTTGGAGGAGGG - Intergenic
1140252280 16:73304623-73304645 TAGATAAGAGGGCTGGAGGAAGG - Intergenic
1141913348 16:87075997-87076019 CCGCCAGTGGGGCTGGAGGAAGG - Intergenic
1142040925 16:87893554-87893576 CGGCCTAAAGGTCTGGAGGGTGG + Intronic
1142675079 17:1508575-1508597 AAGACAGACGGGCTGGAGGAAGG + Intronic
1142675645 17:1511679-1511701 GTGCCAACAGGGATGGAGGACGG + Intronic
1144210121 17:13007538-13007560 CACCCAAACGGGTTTGAGGATGG + Intronic
1145997382 17:29112428-29112450 CAGCCAAAACGGGTAGAGGCTGG + Intronic
1146004362 17:29151524-29151546 CCTCCAAAAGAGGTGGAGGAGGG + Intronic
1146935862 17:36812430-36812452 CAGTGCAAAGGCCTGGAGGAGGG - Intergenic
1147384385 17:40072769-40072791 CAGCCCTAAGGGGTGGAGGTTGG - Intronic
1147566517 17:41539540-41539562 CAGAAGAAAGGGCTGGAGCATGG + Intergenic
1148152933 17:45406918-45406940 CAGCCAGATGGGCTGGAGAATGG + Intronic
1148450528 17:47774848-47774870 GAGTCTAAAGGGCTGAAGGAGGG - Intergenic
1148463260 17:47850159-47850181 CTGCCCCAGGGGCTGGAGGATGG + Intronic
1148697189 17:49567680-49567702 ACCCCAAAAGGGGTGGAGGAAGG + Intergenic
1148887605 17:50785138-50785160 CAGACAACAGGGCTGGAGTGGGG + Intergenic
1150926664 17:69539536-69539558 GAGCCAGAAGGGCAGGGGGAGGG - Intronic
1151828982 17:76538595-76538617 CAGACAAAAAGTCTTGAGGAAGG + Intronic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152212845 17:79012093-79012115 CAGCCACAAGGGCTGCTGGTTGG - Intergenic
1152315089 17:79575443-79575465 CAGCCAGCAGGGCTGGGGGACGG + Intergenic
1152721331 17:81925150-81925172 CAGCCTTGAGGGCTGGAGGAGGG - Intronic
1152809553 17:82375130-82375152 CAGCCAGAAGGGCAGGAAGCAGG - Exonic
1152820603 17:82435875-82435897 CGGCCAACAGGGCTGGGGGAGGG + Intronic
1153267056 18:3281861-3281883 AAGGCAAAAGGGGTGGAGAAGGG - Intergenic
1153540218 18:6146068-6146090 CAGCCAGAAGGCCTGGGTGAGGG + Intronic
1155105942 18:22666582-22666604 AAGTCCAAAGGGCAGGAGGAAGG - Intergenic
1158947977 18:62464278-62464300 CAGCCCAAGGGGCTGAAGAAAGG + Intergenic
1159122147 18:64183539-64183561 AAGCGAGAAGGGCAGGAGGATGG - Intergenic
1160335071 18:78031527-78031549 CAGAGAAATGGGCTGGGGGAGGG - Intergenic
1160726243 19:619012-619034 CAGGCGATAGGGCTGGATGACGG + Exonic
1160769158 19:822464-822486 GAGACAAAAGAGCTGGGGGAGGG + Intergenic
1160842181 19:1151084-1151106 TTCCCAAAAGGGCAGGAGGAGGG - Intronic
1161260837 19:3337009-3337031 CTGCCAACAGGGCTGGGGGTGGG + Intergenic
1161331875 19:3692411-3692433 CAGCCAAGATGGATGCAGGAAGG - Intronic
1161419980 19:4171416-4171438 GGGCCAAAAGGGCTGATGGAGGG - Exonic
1162138505 19:8571037-8571059 CAGGAGGAAGGGCTGGAGGAGGG + Intronic
1163448176 19:17359951-17359973 CAGGCCAAAGGCCTGGAGGCTGG - Intronic
1163743723 19:19032923-19032945 CCGGGAAAAGGGCTGAAGGATGG - Intronic
1164826463 19:31288160-31288182 TAGCCGAAGGGGATGGAGGAAGG + Intronic
1165364905 19:35359426-35359448 CAGCCGCACGGGCAGGAGGATGG - Exonic
1165366723 19:35371895-35371917 CAGCCGCACGGGCAGGAGGATGG - Exonic
1165485648 19:36093973-36093995 CAGGCAAATGGGCTGGTGGTGGG - Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166143499 19:40818817-40818839 CAGCGAAAAGCTCTGCAGGATGG + Intronic
1166184055 19:41127961-41127983 CAGCGAAAAGCTCTGCAGGATGG - Exonic
1166976762 19:46609456-46609478 GAGCCATCCGGGCTGGAGGAGGG - Exonic
1168336334 19:55599577-55599599 GAGCCAAGAGGGCGGGAGAAAGG - Intronic
925376530 2:3389657-3389679 CAGCCGAAGGGGGTGGGGGATGG + Intronic
925448674 2:3950576-3950598 CAGGCAAAAGCGCAGGACGAAGG - Intergenic
925910106 2:8568237-8568259 CAGCAAAAAGGGAGGGAGGGAGG + Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926836851 2:17032509-17032531 CAGGCACCAGGGCAGGAGGATGG + Intergenic
928087166 2:28353027-28353049 CAGAAAAAGGGGCTGGAGGGAGG + Intergenic
928428844 2:31201428-31201450 CAGCTAAGAGGTCTGGATGAAGG - Intronic
928823033 2:35386150-35386172 CAGCGAGATGGGCTGGAGTAAGG - Intergenic
930165434 2:48199326-48199348 CAGCCTAAAGGGGTGGAGTCCGG - Intergenic
930853867 2:55991313-55991335 CAGCCAAGATAGCTGCAGGAAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932785419 2:74597477-74597499 CAGAAAAAAGGGCTGGGGGTGGG - Intronic
933815529 2:86065289-86065311 CAGCGGAAAGGGCTTCAGGATGG + Exonic
934057026 2:88259615-88259637 CAGCCAGAATGTCTGGAGGAAGG + Intergenic
936267819 2:111023708-111023730 CAGAACACAGGGCTGGAGGAAGG + Intronic
937119259 2:119430792-119430814 CCGCCAAAAAGGGTGGAGGTGGG - Intronic
937394816 2:121525504-121525526 CAGCCAAAAGGGGTGGTGCCGGG - Intronic
938992867 2:136647348-136647370 CAGCCCAAGGGGCTGGAACAAGG - Intergenic
941880765 2:170477928-170477950 CGGCCAAAAGGGATGAAAGAAGG - Intronic
943637860 2:190326173-190326195 CCAGCAAAAGGGCTGAAGGATGG + Intronic
943995962 2:194765883-194765905 GAGGCAGAAGGGATGGAGGATGG - Intergenic
945908985 2:215625044-215625066 CATTAAAAAGGGCTGGGGGAGGG + Intergenic
946737598 2:222770075-222770097 CAGGGAGAAGGGCTGGAGCAGGG - Intergenic
946919637 2:224565388-224565410 CAGGCACAAGAGATGGAGGAGGG + Intronic
947622640 2:231600744-231600766 CAGCCAATAGGCATGGAGGCTGG + Intergenic
1170290185 20:14760622-14760644 GAACCAAAAGGCCTGGTGGATGG - Intronic
1171775606 20:29364518-29364540 CAGGCAAAAGGGCTTGTGTAGGG - Intergenic
1171817617 20:29802312-29802334 CAGGCAAAAGGGCTTGTGTAGGG - Intergenic
1171900718 20:30853779-30853801 CAGGCAAAAGGGCTTGTGTAGGG + Intergenic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1173366627 20:42391633-42391655 AAGCCTAAAGAGCGGGAGGAAGG + Intronic
1173470560 20:43320367-43320389 CAGACAGAAGGGCAGGAGGCAGG - Intergenic
1174400636 20:50273975-50273997 CAGCCAGCAGGGCTGGAGCAGGG - Intergenic
1175725881 20:61318030-61318052 GAGACTAAAGGGCTGGAGGGTGG + Intronic
1176061719 20:63175549-63175571 CAGCCAGGCGGGCTGGGGGAAGG - Intergenic
1177109713 21:17010671-17010693 CAACCAAAAGGGAAGAAGGAAGG + Intergenic
1177563897 21:22794069-22794091 CAGGCAAATGGGCAGGAGAAAGG + Intergenic
1178595693 21:33950424-33950446 CAGCTAAAAGGGCAGGGAGAGGG + Intergenic
1178668543 21:34569954-34569976 GAGGCAAAGGGGCTGGAGGAAGG + Intronic
1178697991 21:34810523-34810545 AAGCCAAAAGGGCTTCAGTAAGG + Intronic
1178837097 21:36108011-36108033 CAGCCATAGGAGGTGGAGGAGGG - Intergenic
1179032840 21:37735490-37735512 CAGTGAGAAGGGCTGGAGGAGGG - Intronic
1179969977 21:44830599-44830621 CACCCAAAAGGGGTGGGGGTGGG + Intergenic
1180151564 21:45950805-45950827 GTGCCAACAGGGCTGGAGGGAGG - Intergenic
1180320954 22:11320983-11321005 CAGGCAAAAGGGCTTGTGTAGGG - Intergenic
1180334089 22:11559762-11559784 CAGGCAAAAGGGCTTGTGTAGGG + Intergenic
1181463370 22:23098107-23098129 GAGCCAAGAGGGCTGCAGGCAGG - Intronic
1182114656 22:27749146-27749168 CAGCCAAAAGGACCGGCAGAAGG + Exonic
1182170573 22:28224655-28224677 GAGCTAAATGGGCTGGTGGAGGG + Intronic
1182463795 22:30501544-30501566 CAGCCAAGGGGGCTTAAGGAGGG + Intronic
1183174528 22:36213044-36213066 CAGGCAGAAGGGCTGGAGTGGGG + Intergenic
1185181422 22:49365642-49365664 CAGCCTGGAGGGCTGGTGGACGG + Intergenic
950159354 3:10747996-10748018 AAGGCAAAAAGGCTGGAAGAAGG + Intergenic
950647077 3:14383576-14383598 TGCCCAAAAGGGCTGGAGGAAGG + Intergenic
950827809 3:15843937-15843959 GGGCCAAAAGGGCTAAAGGAAGG + Intronic
952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG + Intronic
953404197 3:42652567-42652589 CTGCAGAAAGGGCTGGAGGTTGG - Intergenic
953589358 3:44236660-44236682 CAGCCATGAGGGCAGGAGGCGGG + Intergenic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
953758868 3:45671250-45671272 CAGCCAAGAAGGCAAGAGGAGGG - Intronic
954464405 3:50646129-50646151 AAGCCACAAAGGCTGGGGGAAGG - Exonic
954894341 3:53963311-53963333 CAGCAGAAGAGGCTGGAGGAAGG + Intergenic
958636845 3:96755791-96755813 CAGCCAAAAGGAATGGGGCAGGG - Intergenic
959255477 3:104006393-104006415 CAGCACAAAGTCCTGGAGGAAGG + Intergenic
959873481 3:111354787-111354809 CAGCCAAAAGGACAAGAGGCAGG + Intronic
960993213 3:123325060-123325082 CTGCCAAGAGGGAGGGAGGAAGG + Intronic
961459905 3:127043558-127043580 CAGCCTGAAAGGCTGGAGGGAGG + Intergenic
961780278 3:129316807-129316829 CATCCAAAGGGGATGGCGGATGG + Intergenic
962362826 3:134756016-134756038 GAGCCAGAGGGGCTGGAGGCAGG + Intronic
962422363 3:135239834-135239856 CAGGCAAAGTGACTGGAGGAGGG - Intronic
963140804 3:141944620-141944642 CAGTCAGAAGTGCTGGAGGTGGG - Intergenic
968488023 4:873586-873608 CAGCACAAAGGGCAGAAGGAGGG - Intronic
968545479 4:1195590-1195612 CAGCAAGCAGGGCTGGAGGGTGG + Intronic
969396642 4:6925905-6925927 CAGCGAGAAGGGCCTGAGGATGG + Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969524523 4:7697407-7697429 CAGCCAAAGTGGCTGGAGCCAGG + Intronic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
969722208 4:8898339-8898361 AAGCCAGAAGGGCTGGGGGAAGG + Intergenic
970464702 4:16310877-16310899 CTTATAAAAGGGCTGGAGGAGGG + Intergenic
970587403 4:17527774-17527796 CAGCCATAAGGGACCGAGGAGGG + Intergenic
970645600 4:18117004-18117026 CAGCTTAAAGGGCAGGGGGATGG + Intergenic
971385584 4:26138215-26138237 GAGCCAAAATGTCTGGAGGTTGG - Intergenic
973961176 4:56111358-56111380 TAGGAAAAAGGGATGGAGGAGGG + Intergenic
975318991 4:72988690-72988712 CAGCCAAAATTCCTGAAGGAGGG + Intergenic
975552923 4:75631177-75631199 CAGCCAAATGGGGTGGAGTTAGG + Intergenic
976200877 4:82577555-82577577 CAGGCAGAATGGCTGGATGATGG - Intergenic
979521139 4:121668397-121668419 CAGCTAAAGGTGCTGAAGGAAGG + Exonic
980494526 4:133574590-133574612 CAGCCAGAAGGGGTAGAAGAGGG + Intergenic
981173402 4:141651421-141651443 AATCCAAAAGGTTTGGAGGATGG + Intronic
982563949 4:156965711-156965733 AAGCCAAAAGAGCTGCAGGAAGG + Intronic
985648463 5:1096288-1096310 CAGCCAACATGGCAGGAGGTTGG + Intronic
992418055 5:76572018-76572040 CAGGGAACAGGGCTGGGGGAGGG - Intronic
992483399 5:77173092-77173114 CTGCCAAAAACTCTGGAGGAAGG - Intergenic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993055099 5:82971797-82971819 CAGCCATAGGAGGTGGAGGAGGG + Intergenic
994038113 5:95225817-95225839 CAAACAAAAGGGAGGGAGGAAGG - Intronic
994314490 5:98316556-98316578 CATACAAAAGGGCTGGTGGGGGG + Intergenic
995374814 5:111462063-111462085 AAGCCAACATGGCTGGAGCATGG - Intronic
995544081 5:113212868-113212890 CAGCTTAAAGAGCTGGAGCAAGG - Intronic
995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG + Intergenic
998697230 5:144653834-144653856 CAGGCAAAAGAGCTGGTGCAGGG + Intergenic
998998060 5:147888241-147888263 CAGCCAAAAGCTCTTGAGCAAGG - Intronic
999893884 5:156007814-156007836 AAGGCAAACGGGCTGGAAGAGGG + Intronic
1000786659 5:165553096-165553118 GAGCCAAGAAGGATGGAGGATGG - Intergenic
1001210495 5:169806467-169806489 CAGCCAAATGGGTAGGAAGATGG + Intronic
1001277497 5:170361187-170361209 CACCCAGAAGTGCAGGAGGAGGG + Intronic
1001548351 5:172584480-172584502 CAGCAAGAGGGGCTGGAGGTGGG + Intergenic
1003276862 6:4660923-4660945 CAGCCAAGAGGGCTGGCAGCTGG - Intergenic
1003514950 6:6810211-6810233 CAGGTACAAGGACTGGAGGATGG + Intergenic
1003763584 6:9210317-9210339 CATCCAAAAAGACTGCAGGAAGG + Intergenic
1005709651 6:28490842-28490864 CAGTCCAAAGCGCTGGATGAAGG + Intergenic
1005968596 6:30744005-30744027 CAGATTAAAGGGCTCGAGGACGG + Exonic
1006077303 6:31542037-31542059 CAGCCAAGAAGGCGGGAGGCTGG - Exonic
1006470778 6:34227455-34227477 GAGTGAAAAGGGCTGGGGGAGGG - Intergenic
1006837155 6:37005930-37005952 CTGCCAGAAAGGCTGGAGGGTGG - Intronic
1006921466 6:37630325-37630347 CAACCAGCTGGGCTGGAGGAAGG - Intergenic
1007461470 6:42022384-42022406 CACACAAAAAGGGTGGAGGATGG + Intronic
1007710419 6:43819580-43819602 CAACCAAAAGTGCTGGAAGCAGG + Intergenic
1007812922 6:44498996-44499018 CAACCAAAAGGGCTGGGGAGAGG - Intergenic
1007990164 6:46246819-46246841 CAGCCAACAGGTGGGGAGGAAGG + Exonic
1008208739 6:48694553-48694575 AACCCCAAAGTGCTGGAGGAGGG + Intergenic
1008209427 6:48702667-48702689 GAGCCAGAAGAGCTGGAGAAAGG + Intergenic
1008542229 6:52555216-52555238 GAGCGAAGAGGGCAGGAGGAGGG - Intronic
1008657108 6:53627321-53627343 CAGCCAGAAAGGCTGAAGGAAGG - Intergenic
1008952085 6:57172421-57172443 GAGCCACACGGGCTCGAGGATGG - Exonic
1010816504 6:80364325-80364347 CAGCCAAGAGGCCTGCAGGGAGG + Intergenic
1011085753 6:83538482-83538504 CAACCATCAGGGCTGGAGGAGGG - Intergenic
1011173909 6:84539300-84539322 CAGCCAAATGGGCTGTTGGGTGG - Intergenic
1011489304 6:87874261-87874283 AAGGCAGAAGGGCAGGAGGAGGG + Intergenic
1012744633 6:103069966-103069988 GAGGCAAGAGGGCAGGAGGAGGG - Intergenic
1012855541 6:104497028-104497050 AAGACAAGAGGGCTGGCGGAGGG + Intergenic
1013330414 6:109094909-109094931 CAGCCCAGAGGGCGGGAGCAGGG + Intergenic
1013698436 6:112731908-112731930 CAGCCAAAAGGGGTGTATGTGGG + Intergenic
1013888033 6:114994790-114994812 CAGCCATAAGGGCTGCTGGTTGG - Intergenic
1014562155 6:122904476-122904498 CAGGCAAAAGGGCTTGTGCAGGG - Intergenic
1014876474 6:126667271-126667293 GAGCCAGAAGGACTGGAGGCTGG - Intergenic
1017563226 6:155655762-155655784 AATCCAATAGTGCTGGAGGAAGG - Intergenic
1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG + Intronic
1018873905 6:167803666-167803688 GAGCCAACAGGGCTGGGGAATGG - Intergenic
1019357142 7:586499-586521 CCCCCAACAGGGCTGGAGGGTGG - Intronic
1022097153 7:27148139-27148161 AAGCAAAAAGGGGAGGAGGAAGG - Intronic
1023307033 7:38841450-38841472 CCACCAAAATGGCTGGGGGAAGG + Intronic
1023629866 7:42153531-42153553 CAGCCAAAATGAAGGGAGGATGG + Intronic
1024471550 7:49772662-49772684 CAACCAACAGGGCTGGATGGAGG - Intergenic
1024825611 7:53386464-53386486 CAGACCACAGGGCTGGAGCAGGG - Intergenic
1025075921 7:55943094-55943116 CAGCAAAAAGGAATGTAGGAGGG + Intergenic
1025190067 7:56889552-56889574 CAGGCAAAATGGCTGGAGTGGGG - Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1025681873 7:63687369-63687391 CAGGCAAAATGGCTGGAGTGGGG + Intergenic
1027267132 7:76500638-76500660 AAACCAAAGGGGCTGGAGCAAGG - Intronic
1027318945 7:77000506-77000528 AAACCAAAGGGGCTGGAGCAAGG - Intergenic
1028522312 7:91745791-91745813 TAGCATAAAGGGCAGGAGGAAGG - Intronic
1028703644 7:93813081-93813103 CAAGCAAAATGGCTGGGGGATGG - Intronic
1029540469 7:101179621-101179643 CAGCCAAAGGGGGTGGGGGGAGG + Intronic
1030307194 7:108030909-108030931 CAGCGATCAGGGCTGGAGGATGG - Exonic
1031020313 7:116620617-116620639 CAGCCAGAAGGGCTGGAAAGTGG + Intergenic
1032513273 7:132488892-132488914 CAGCCAGAAGGGCTGGAGCAAGG + Intronic
1032980907 7:137281536-137281558 CATTCAAAAGTGCTGGAGTAAGG - Intronic
1033245797 7:139715339-139715361 CGTGCAGAAGGGCTGGAGGAAGG - Intronic
1035351143 7:158247248-158247270 TGGCCAAGAGGGGTGGAGGAAGG + Intronic
1038624929 8:29182501-29182523 CAGCCTAAGGGGGCGGAGGAGGG + Intronic
1039314491 8:36356490-36356512 GAGACAAAAGGGAAGGAGGAAGG + Intergenic
1039334241 8:36572405-36572427 AAACCAAAAGGGAAGGAGGAAGG + Intergenic
1039455682 8:37704526-37704548 CAGCCACAGGAGCTGGAGGAGGG + Intergenic
1039517844 8:38148211-38148233 CAACCAAGAGGGCTGGAAGAAGG - Exonic
1041102960 8:54415146-54415168 CAGACAACACAGCTGGAGGAGGG - Intergenic
1041840804 8:62268470-62268492 CAGCAAGAAGGACTGGAGAATGG + Intronic
1044259281 8:90098547-90098569 CACCCTAGAGGGCTGCAGGAAGG - Intergenic
1044958717 8:97508221-97508243 CAGCCAAACAGGGTTGAGGAGGG - Intergenic
1045163914 8:99581385-99581407 CAGCCAAAATGACTGGATGATGG + Intronic
1045850135 8:106686120-106686142 CAGGCAAAAGGGTGGGAGCAGGG + Intronic
1048922832 8:139246478-139246500 CAGCCTAAAGGACTGGAGGTAGG - Intergenic
1049749074 8:144275074-144275096 CAGCCAAGAGAGCCGAAGGATGG + Intronic
1052861182 9:33438930-33438952 CAGCCAGAACTGCTGGTGGAAGG + Intergenic
1053460834 9:38269914-38269936 GAGCCCAAAGGCCTGAAGGATGG + Intergenic
1054824377 9:69557504-69557526 CAGGCAACAGGGCAGCAGGAGGG - Intronic
1055292056 9:74792461-74792483 TAGCAAAGAGGACTGGAGGAAGG - Intronic
1055356939 9:75447319-75447341 AAGCCATAAGGGTTGGAGGCTGG + Intergenic
1056118342 9:83462719-83462741 CAGCCGAAATTGCTGGAAGATGG - Intronic
1056332966 9:85536951-85536973 CATCCAAAAGGTCTGATGGAGGG + Intergenic
1057110306 9:92463579-92463601 CAGCCTACAGGGCTGGAGGAGGG - Intronic
1059697405 9:116742448-116742470 CTTCCAAAAGGCCAGGAGGAGGG - Intronic
1060102347 9:120851605-120851627 CAGGCACAAGGGCATGAGGATGG + Intergenic
1061112630 9:128585737-128585759 CAGCAAAATGGCCTGGAAGATGG - Exonic
1061454234 9:130685644-130685666 CATCAGAAAGGGCTGAAGGAAGG - Intergenic
1062262697 9:135670830-135670852 CAGGCGAGAGGGCTGGAGGCGGG - Intergenic
1062381598 9:136289586-136289608 CCCCCACAAGGGCTGCAGGAGGG + Intronic
1062430786 9:136526070-136526092 CGGCCACATGGGATGGAGGAGGG - Intronic
1062681259 9:137782720-137782742 CAGTCAACGGGGCTGGGGGAGGG - Intronic
1203369175 Un_KI270442v1:286758-286780 CAGGCAAAAGGGCTTGTGTAGGG - Intergenic
1186482243 X:9904768-9904790 CAGCCAAGAGGAATGGAGGCTGG - Intronic
1189293343 X:39901375-39901397 CAGCCTCAAGACCTGGAGGATGG + Intergenic
1189478482 X:41375221-41375243 CAGCCAACTGGGCAGGAGGGTGG - Intergenic
1191864144 X:65690414-65690436 AACCCAAAAGTGCTGGAGGAAGG + Intronic
1192584509 X:72308605-72308627 CAGCCTTGAGGGCTGGAGAATGG - Intergenic
1193844823 X:86455603-86455625 AATCCAAATGGTCTGGAGGAGGG - Intronic
1197620591 X:128743369-128743391 CAGACACAAGGGCTGGTGGTTGG - Intergenic
1198474283 X:136980980-136981002 CAACATAAAGGGATGGAGGAAGG - Intergenic
1199458844 X:148060367-148060389 CAGGCAAAAGAGCTTGAGCAGGG + Intergenic
1200700225 Y:6395833-6395855 CAGCCAAAAGATCTGTAGGGAGG + Intergenic
1201033886 Y:9768865-9768887 CAGCCAAAAGATCTGTAGGGAGG - Intergenic
1201069104 Y:10128203-10128225 CAGGCAAAAGGGCTTGTGTAGGG + Intergenic