ID: 1072431592

View in Genome Browser
Species Human (GRCh38)
Location 10:95376980-95377002
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072431589_1072431592 9 Left 1072431589 10:95376948-95376970 CCAAATAAGTATAAAGTTCTGGC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1072431592 10:95376980-95377002 CATGGAATAACACGTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr