ID: 1072434250

View in Genome Browser
Species Human (GRCh38)
Location 10:95400994-95401016
Sequence AGGTGTAAGCAGGAAGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072434244_1072434250 -2 Left 1072434244 10:95400973-95400995 CCAGATTGCACAGAGGGTTGAAG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1072434250 10:95400994-95401016 AGGTGTAAGCAGGAAGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072434250 Original CRISPR AGGTGTAAGCAGGAAGTTGG GGG Intronic
No off target data available for this crispr