ID: 1072434923

View in Genome Browser
Species Human (GRCh38)
Location 10:95406113-95406135
Sequence GACTCAGTAGCCTTTCAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072434923 Original CRISPR GACTCAGTAGCCTTTCAGGT AGG (reversed) Exonic
903066859 1:20704442-20704464 GCCCCAGCAGCCTGTCAGGTGGG - Exonic
906283692 1:44571457-44571479 GACACAGTGGCATGTCAGGTAGG - Intronic
923044789 1:230347795-230347817 GACCCAGGAGCCTATCAGTTAGG - Intronic
924732618 1:246725456-246725478 GACTCCGTAGCCTTTAAATTTGG + Intronic
1070916239 10:80156883-80156905 GACTCAGTAGCATTTGATGATGG - Intronic
1071165139 10:82797419-82797441 GTCTCACTGGCATTTCAGGTGGG + Intronic
1072434923 10:95406113-95406135 GACTCAGTAGCCTTTCAGGTAGG - Exonic
1073077117 10:100831033-100831055 GATTCAAGAGCCTTTCAAGTGGG - Intergenic
1073723867 10:106207263-106207285 ATCTCATTAGCCTATCAGGTTGG + Intergenic
1079893952 11:26095102-26095124 GAATAAGTAGCCTTTAAGTTTGG - Intergenic
1079997352 11:27308038-27308060 GACACAGTAGCCATTGAAGTGGG + Intergenic
1084421593 11:69063231-69063253 GACTCAGCAGCCTTCGAGCTGGG - Intronic
1084722671 11:70917837-70917859 GACACAGGAGCCTTTCAGGGGGG + Intronic
1087173655 11:95076150-95076172 GAGTATGTAGCCTTTCAGATTGG + Intergenic
1087278247 11:96181739-96181761 TACTCAGTATCTTTTCAGTTTGG - Intronic
1088844090 11:113650256-113650278 GATTTAGTAGCTCTTCAGGTAGG + Intergenic
1097430703 12:59502052-59502074 TACTCATTAGCCTGACAGGTAGG + Intergenic
1113487272 13:110663379-110663401 GACACAGAAGCCTTTAAGATGGG + Intronic
1118078497 14:62329306-62329328 GTCTCAGGAGACTTTCAGGGTGG + Intergenic
1118741098 14:68739802-68739824 CATTGAGTAGCCTGTCAGGTGGG - Intergenic
1120424000 14:84323805-84323827 GACTCTTTAGCCTTTCTGGAGGG + Intergenic
1127779410 15:62298206-62298228 GATGCAGAAACCTTTCAGGTGGG + Intergenic
1137362860 16:47835581-47835603 GACTCATTAGCATTTCTTGTAGG - Intergenic
1142803785 17:2361257-2361279 GACTCGGGAGCCTTTCTGGAGGG - Intronic
1155321751 18:24626034-24626056 GACTAAGTGGTATTTCAGGTGGG - Intergenic
1166321832 19:42023535-42023557 GAAGCAATGGCCTTTCAGGTGGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
926542041 2:14192976-14192998 GGCTCAGTCTCCTTTCTGGTGGG + Intergenic
926781561 2:16477322-16477344 GACCCATTAGACTTCCAGGTAGG - Intergenic
927414964 2:22869511-22869533 AACTCAGTAGAGTTTCATGTTGG + Intergenic
929487495 2:42367869-42367891 GACACGGTAGCCTTGCAGTTTGG - Intronic
931668199 2:64625065-64625087 GACTCTGCTGCCTTTCAGCTGGG + Intergenic
933750423 2:85599508-85599530 TCCTCAGTATCCTTTCAGGACGG - Exonic
935023978 2:99258534-99258556 GACTCTGTAGCCTGCCTGGTAGG + Intronic
935709553 2:105885592-105885614 GAATCAGTACCATTTCAGGTAGG - Intronic
936877051 2:117202613-117202635 TACACAGTAGCCTTTTAGGTTGG - Intergenic
937281500 2:120720392-120720414 GGCTGAGTAGCTTTGCAGGTAGG + Intergenic
939153749 2:138501517-138501539 GTCTCAGTAGGCTTTTAGGCAGG + Intergenic
942645023 2:178101329-178101351 GACTCAGAAGCTTTTCATTTGGG - Intronic
945418210 2:209600871-209600893 GACTATGTAGCCTTTCCTGTAGG + Intronic
947785186 2:232811719-232811741 AACTCAGAAGCCATTAAGGTAGG + Intronic
948788501 2:240365310-240365332 GACGCAGTTTCCCTTCAGGTTGG - Intergenic
1168790797 20:574570-574592 GACTCAGGTGACCTTCAGGTTGG + Intergenic
1170067991 20:12335227-12335249 AACTCAGTAGCCTATGAGGAAGG - Intergenic
1172021287 20:31916111-31916133 GACTCAGTTGCCTTCCAGGTGGG + Intronic
1175717884 20:61267484-61267506 GCCTCATTTGCCTTTCTGGTGGG - Intronic
1182967104 22:34532621-34532643 CACTCAGTGGCCTTCCATGTGGG + Intergenic
1185371625 22:50463519-50463541 GACCCAAATGCCTTTCAGGTGGG + Intronic
951843759 3:27063260-27063282 CACTCAGTCGCTTTTCAGGAGGG + Intergenic
952915457 3:38235634-38235656 GACTCTGTAGTCTTCCAGGGAGG + Intronic
954259620 3:49429184-49429206 GGCTCCGTAGCCCTCCAGGTGGG - Exonic
955009542 3:55000765-55000787 GACTCATCAGCCCTTCAGCTTGG + Intronic
956479080 3:69654967-69654989 GAATCGGTAGTCTTCCAGGTAGG - Intergenic
959256250 3:104018536-104018558 GAATCAGTAGCATCTCAGCTAGG + Intergenic
961772177 3:129258093-129258115 CACTCTGGAGCCTGTCAGGTTGG + Intronic
965138360 3:164803833-164803855 GTCTCAGAAGACCTTCAGGTGGG - Intergenic
965410567 3:168325535-168325557 GACTCTGTAGCCTTTCTAATGGG + Intergenic
968904619 4:3445613-3445635 GCCGCAGAAGCCTTTCAGGGAGG + Intronic
971588262 4:28432816-28432838 GTCTCTGTAGCCCTCCAGGTGGG + Intergenic
972067009 4:34960218-34960240 GTCTCAATAGTCTCTCAGGTTGG - Intergenic
976070371 4:81233405-81233427 GACTCTGTATCATTTCAGGTAGG - Intergenic
978741552 4:112143654-112143676 AACCCAGTAGCCTTTCTGATGGG - Intergenic
981834088 4:149035261-149035283 AACTCACTTGCCTTTCAGTTAGG - Intergenic
984352465 4:178613249-178613271 GATTCAGTGGCATTCCAGGTGGG - Intergenic
984521529 4:180807807-180807829 AGGTCAGTAGTCTTTCAGGTAGG - Intergenic
985080094 4:186255839-186255861 GAATCATTAGCCTTAGAGGTTGG + Intronic
985508856 5:300432-300454 TACTCTGTACCCTTTCAAGTTGG + Intronic
985739268 5:1605484-1605506 TACTCTGTACCCTTTCAAGTTGG - Intergenic
985887419 5:2690348-2690370 ATCTCAGGAGCCTTCCAGGTTGG + Intergenic
991928541 5:71728948-71728970 CACAGAGTAGACTTTCAGGTGGG + Intergenic
996300839 5:121982751-121982773 CACTCAGTAGCCTCTGAAGTAGG - Intronic
1000758017 5:165184694-165184716 GACTCAGTACCAGTTAAGGTTGG + Intergenic
1009896558 6:69758372-69758394 GACTCAGGAGTTTTTCAGCTGGG - Intronic
1014271155 6:119337758-119337780 AACTCAGTAGCTTTAAAGGTGGG - Intronic
1014801836 6:125787179-125787201 GACTCAGGAGCCTTTCATTTGGG + Intronic
1018663826 6:166114661-166114683 GCCTCAGGAGCCCTTCAGGAGGG + Intergenic
1020814924 7:12893562-12893584 GACACACTATCCTTTCAGCTTGG + Intergenic
1022239599 7:28497175-28497197 GACAGAGCAGCCTTTCAGGCAGG + Intronic
1023154427 7:37233901-37233923 GATTCAGTAGGCTATAAGGTGGG + Intronic
1023862091 7:44222829-44222851 GACTCAGTCACCTGCCAGGTGGG - Intronic
1029736953 7:102470313-102470335 GTCTCAGAGGCCTTCCAGGTGGG - Intronic
1029924963 7:104305595-104305617 CACTCAGCAGCCTCACAGGTAGG + Intergenic
1034384921 7:150732993-150733015 GTCTCATTAGGCTTTCAGGAGGG + Intronic
1044319636 8:90787925-90787947 GACTCAGAATCCTTTCAGTCAGG - Intronic
1051775073 9:20623336-20623358 AACTCAGTAGGCTGTCAGGAGGG - Intergenic
1054453143 9:65413872-65413894 GAGTCAACAGCCTTTCAAGTGGG - Intergenic
1055596051 9:77865179-77865201 GCCTCAGTGGCCTTTCAGGTAGG - Intronic
1055873215 9:80910809-80910831 TATTCAGTGCCCTTTCAGGTAGG + Intergenic
1196494661 X:116310425-116310447 GTCTCAGTCGCCTTTCAAATGGG + Intergenic
1196576086 X:117320739-117320761 GAATCAGAAGCCCTGCAGGTGGG + Intergenic
1200147087 X:153931977-153931999 GGCTGAGTTGCCTTCCAGGTCGG - Intronic