ID: 1072436168

View in Genome Browser
Species Human (GRCh38)
Location 10:95416218-95416240
Sequence CAGGGAAAAAAGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072436163_1072436168 10 Left 1072436163 10:95416185-95416207 CCTTTAGCAATATTTTCAAGATA 0: 1
1: 0
2: 1
3: 47
4: 414
Right 1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072436168 Original CRISPR CAGGGAAAAAAGAAAGAGGA GGG Intronic
No off target data available for this crispr