ID: 1072436190

View in Genome Browser
Species Human (GRCh38)
Location 10:95416436-95416458
Sequence GCATGTGGCCTGCTACGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072436190_1072436194 4 Left 1072436190 10:95416436-95416458 CCAGCCCGTAGCAGGCCACATGC 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1072436194 10:95416463-95416485 TCAATTGTGACACCAATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072436190 Original CRISPR GCATGTGGCCTGCTACGGGC TGG (reversed) Intronic
902600338 1:17536558-17536580 AGATGTGGCCTGCTGAGGGCTGG + Intergenic
903759386 1:25687211-25687233 GCATGGGGCCTGCTACTGCCTGG + Intronic
913175980 1:116273606-116273628 GCAGCCGGCCTGCTACGGGGAGG + Intergenic
1072436190 10:95416436-95416458 GCATGTGGCCTGCTACGGGCTGG - Intronic
1073439720 10:103545302-103545324 GCATGTGGCTGGCTCAGGGCTGG - Intronic
1077073910 11:691238-691260 GCTTGTGGCCTGCGTTGGGCAGG - Intronic
1077535711 11:3123002-3123024 GCATGTGCCCAGCTCTGGGCAGG + Intronic
1078317727 11:10306321-10306343 GCATCCGGACTGCTGCGGGCGGG - Exonic
1079104541 11:17561796-17561818 CCATGTGGCCTGGTAAGAGCTGG + Exonic
1083813934 11:65121506-65121528 GCATGCGGCCTGCTACTTCCAGG + Exonic
1084004800 11:66317086-66317108 GCCTGGGGCCTCCTGCGGGCGGG + Intergenic
1085496410 11:76973584-76973606 GTAGGGGGCCTGCTAGGGGCAGG - Intronic
1089169183 11:116500465-116500487 GACTGTGGCCTGCGCCGGGCCGG - Intergenic
1090349067 11:126095682-126095704 ACATGTGGCCTCCTGCGGGAAGG - Intergenic
1091343915 11:134840024-134840046 GAATGTGGCTTGCCAGGGGCTGG - Intergenic
1091404824 12:202695-202717 GGATGTTGCCTGTTAGGGGCTGG - Intronic
1092321259 12:7477570-7477592 ACATGGGGCCTGCTGCGGGGTGG + Intronic
1092793703 12:12090681-12090703 GCTTGTGGCTTGGTAAGGGCTGG - Intronic
1096241681 12:49963119-49963141 GCATGGGGCCAGGCACGGGCAGG + Intronic
1105325933 13:19370639-19370661 GGATGTGGGCTGCTCCGGGGAGG + Intergenic
1105867574 13:24474455-24474477 GGATGTGGGCTGCTCCGGGGAGG - Intronic
1113731127 13:112642280-112642302 GCATGTGCCCTGCAATGGGAAGG + Intergenic
1121007459 14:90499503-90499525 TCAGGTGGCCTTCTAAGGGCGGG - Intergenic
1128754005 15:70169177-70169199 GCATGTTGCCTGCCAGGGCCTGG - Intergenic
1128894813 15:71363068-71363090 GCATGTGGCCTGCGGGCGGCAGG + Intronic
1132214911 15:100055354-100055376 GCTTGTGGCCTGCTCCAGCCTGG - Intronic
1132750389 16:1454873-1454895 GCATGGGGCCTCCCACGGCCTGG - Intronic
1132834443 16:1945755-1945777 CCCTGCGGCCTGCTACGAGCGGG - Intronic
1140563582 16:76012849-76012871 GCATGTGGCCAGGTCAGGGCCGG - Intergenic
1141450345 16:84095690-84095712 GCTTCTGGCATGCTACGGGAAGG - Exonic
1142215179 16:88826404-88826426 GCATGTGCCCGGGTACAGGCAGG + Intronic
1142756393 17:2018869-2018891 GCATGTGGACAGTGACGGGCAGG + Intronic
1143163386 17:4885635-4885657 GCATGGGGGCTGCCAAGGGCGGG + Intronic
1148110058 17:45139286-45139308 GCATGGCTCCTGCTACAGGCAGG + Intronic
1148674710 17:49438681-49438703 GCCTGTGGCCAGGCACGGGCGGG - Intronic
1148856464 17:50581604-50581626 GCATGGGGCCAGCCCCGGGCGGG - Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1150981844 17:70151282-70151304 GCCTGTGGCCTGTTACGAACTGG + Intergenic
1154297017 18:13160482-13160504 GCCTGTGGCCTGATGCAGGCAGG + Intergenic
1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG + Intergenic
1159938842 18:74390084-74390106 GCATGCGGCCTGCTACTTCCAGG + Intergenic
1160603904 18:80034494-80034516 CCATGTGGGCTGCGGCGGGCGGG + Exonic
1160950766 19:1666138-1666160 GCATGTGCCCTGCACCTGGCCGG + Intergenic
1161116512 19:2499940-2499962 GCATGTGGCCTTCGAGGGGAGGG + Intergenic
1163758123 19:19119039-19119061 GCAGGTGGCCTGGGACGGACGGG - Intergenic
1167369516 19:49072291-49072313 AGAGGTGGCCTTCTACGGGCTGG - Exonic
1168064775 19:53912883-53912905 GCGTGTGGCCTGCTCCTGGTAGG + Exonic
927637581 2:24827423-24827445 GCACGTGACCTGATACGTGCAGG - Intronic
929896359 2:45964015-45964037 GAATGTGGCCTGCCACTGACTGG + Intronic
938307275 2:130264652-130264674 GCATGGGGCCTGGTGCTGGCAGG + Intergenic
941010786 2:160297322-160297344 GCAGGTGGCATGCTAGTGGCTGG + Intronic
944170743 2:196773928-196773950 GCCCGTGGCCTGCTAGGGACTGG - Intronic
947749542 2:232525290-232525312 GCATGTGGCCTTCAGCGGCCTGG + Exonic
1168821047 20:774101-774123 CCATCTGGCTTGCCACGGGCTGG + Intergenic
1170782726 20:19439908-19439930 GCATGTGGCCAGCTTTGGGTGGG + Intronic
1171056341 20:21910529-21910551 GCATGCAGCCTGCTAAGGGACGG + Intergenic
1180877418 22:19181089-19181111 GCATGTGGCCTGCTTATGGGGGG + Intronic
1180996537 22:19968536-19968558 GAATGTGGCCTGCTGCGGAAGGG + Exonic
1181810477 22:25400923-25400945 GGCTGTGGCTTGCTACGAGCTGG - Intronic
949596465 3:5553088-5553110 GCCAGTGCCCTGCTACTGGCTGG - Intergenic
949903722 3:8840886-8840908 GCATTTTGCCTGCTGCTGGCTGG - Intronic
952313302 3:32209885-32209907 TCATGTGGCCTACTACAGGATGG + Intergenic
952836403 3:37606006-37606028 GCATGTGGCCTTCTGCCTGCAGG - Intronic
953411009 3:42690531-42690553 GCTGGGGGCCTGCTAGGGGCTGG + Intronic
954629448 3:52040155-52040177 GCATGAAGCCTGCTCTGGGCCGG - Intergenic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
955362563 3:58288238-58288260 GAATTTGGCCTGGTAGGGGCAGG - Intronic
967746328 3:193059972-193059994 CAATGTGGCCTGCTAAGGGCTGG - Intergenic
969604267 4:8194574-8194596 GTTTCTGGCCTGCTCCGGGCTGG - Intronic
987326860 5:16820278-16820300 GGATGTGGCGTGCTAGGGGAAGG - Intronic
992153130 5:73926106-73926128 GCATGTGCCCTGCCCTGGGCTGG - Intronic
1003111744 6:3256809-3256831 GTATGTGGGCTGCCACGGGGAGG + Intronic
1005090938 6:22056613-22056635 GCGTGTGGCGTGCTTCGGGCAGG - Intergenic
1007088366 6:39166608-39166630 GCATGTGACGATCTACGGGCGGG + Intergenic
1011555157 6:88565972-88565994 GCATGTGGCAAGCCACGAGCTGG - Intergenic
1015097751 6:129436294-129436316 GCATTTGGCATGGTAGGGGCTGG - Intronic
1020170454 7:5840861-5840883 GCAGGTGGCCTGCAGGGGGCCGG + Intergenic
1021918272 7:25456968-25456990 GCATGTGGCCTGCTGACAGCTGG + Intergenic
1022476416 7:30713545-30713567 GCATGGGGGCGGCTAGGGGCAGG + Intronic
1023722348 7:43110028-43110050 GCATGTGGCCTGAGATGAGCAGG + Intergenic
1026005713 7:66598881-66598903 ACATGTGGCCTGCTAGGAACTGG - Intergenic
1026399607 7:69996236-69996258 GCATGGGGCCTGCTATGGCAAGG + Intronic
1029604062 7:101588022-101588044 GCCTGTGACCTGCTCTGGGCTGG + Intergenic
1030128410 7:106176899-106176921 GCATGAGGCCTGACCCGGGCTGG + Intergenic
1044017313 8:87059781-87059803 CCATGTGGCCTGATATGGTCTGG - Intronic
1045276559 8:100711351-100711373 GCATGTGGCCTGCAAGCAGCGGG + Intronic
1046728741 8:117702544-117702566 GCATGTGCCCTGCTAAGGACAGG - Intergenic
1049397137 8:142406144-142406166 CCATGTGGCCAGCAAGGGGCAGG + Intergenic
1049431023 8:142564964-142564986 GCATGGGGCCAGCCACGGGAAGG + Intergenic
1058648193 9:107150285-107150307 GCATGTGGCCTCAGAGGGGCAGG - Intergenic
1060720311 9:125972190-125972212 GCAGGTGGCCTGCTTCCGTCTGG + Intergenic
1060899065 9:127241574-127241596 GCATGTGGCCTGCTGGGCCCAGG + Intronic
1062534353 9:137014993-137015015 GCATGTGGCCTCCTGCCTGCTGG - Exonic
1190259443 X:48788770-48788792 GCATGTGGCTGGGTACGGTCAGG + Intronic
1190748535 X:53341385-53341407 GCATGTGGCCGGCTGCACGCTGG + Intergenic
1190760590 X:53434619-53434641 GCAAGTGGCCTGCTCCGCGTGGG + Intergenic
1195877559 X:109557969-109557991 GCATTTGGCCTTGTAAGGGCTGG + Intergenic
1200249211 X:154543312-154543334 GCCTGTGGCCAGCTTCGGGTTGG - Intronic
1201861413 Y:18601377-18601399 GCATGTGCACTGCTGAGGGCAGG - Intergenic
1201871910 Y:18719003-18719025 GCATGTGCACTGCTGAGGGCAGG + Intergenic