ID: 1072436190

View in Genome Browser
Species Human (GRCh38)
Location 10:95416436-95416458
Sequence GCATGTGGCCTGCTACGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072436190_1072436194 4 Left 1072436190 10:95416436-95416458 CCAGCCCGTAGCAGGCCACATGC No data
Right 1072436194 10:95416463-95416485 TCAATTGTGACACCAATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072436190 Original CRISPR GCATGTGGCCTGCTACGGGC TGG (reversed) Intronic