ID: 1072438322

View in Genome Browser
Species Human (GRCh38)
Location 10:95433265-95433287
Sequence CTGTGAAGACAGCTGAGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 483}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072438322_1072438328 7 Left 1072438322 10:95433265-95433287 CCGAGCCTCAGCTGTCTTCACAG 0: 1
1: 0
2: 5
3: 49
4: 483
Right 1072438328 10:95433295-95433317 GCGTCTCCTACAGTTTCACTAGG No data
1072438322_1072438331 26 Left 1072438322 10:95433265-95433287 CCGAGCCTCAGCTGTCTTCACAG 0: 1
1: 0
2: 5
3: 49
4: 483
Right 1072438331 10:95433314-95433336 TAGGGCCTAATAACAGACCCAGG No data
1072438322_1072438329 8 Left 1072438322 10:95433265-95433287 CCGAGCCTCAGCTGTCTTCACAG 0: 1
1: 0
2: 5
3: 49
4: 483
Right 1072438329 10:95433296-95433318 CGTCTCCTACAGTTTCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072438322 Original CRISPR CTGTGAAGACAGCTGAGGCT CGG (reversed) Intronic
900339989 1:2183771-2183793 CTGTCAAGACAGCTTGGGCATGG - Intronic
901277590 1:8004785-8004807 CTGTGAAGATAGCACGGGCTGGG - Intronic
901895467 1:12308128-12308150 CTGTGACAACAACTGAGGCTGGG - Intronic
901900261 1:12355166-12355188 CTGTAACAACAGCTGAGTCTTGG - Intronic
901916400 1:12503825-12503847 CAGTGAAGACAGGAGAGCCTGGG + Intronic
902383691 1:16064644-16064666 CTGAGAAGACAGGAGATGCTTGG - Intronic
902982004 1:20130776-20130798 CTGTTAAGATAGTGGAGGCTGGG - Intergenic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903279079 1:22239766-22239788 CAGAGCAGAAAGCTGAGGCTTGG - Intergenic
904334035 1:29785467-29785489 CTGTGGAGTCAGCAGAGGCCTGG + Intergenic
904424698 1:30415820-30415842 CTGAGGAGGGAGCTGAGGCTGGG - Intergenic
904721024 1:32508629-32508651 CTGTGAAGTCAGCCTAGGGTGGG + Intronic
905032867 1:34899557-34899579 CTGTGGAGAGAGCTCAGGCCTGG - Intronic
905242032 1:36587609-36587631 CTGTGCAGGCTACTGAGGCTTGG + Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
906199913 1:43953328-43953350 TTATGACCACAGCTGAGGCTGGG - Intronic
907044147 1:51289452-51289474 CAGGAAAGACATCTGAGGCTGGG - Intronic
907588246 1:55640927-55640949 CTGAGAAGGCAGCTGAGGTTGGG + Intergenic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
909377056 1:74952193-74952215 GTGGGAAGGCAGCCGAGGCTCGG + Intergenic
910493388 1:87798214-87798236 CTATCATGACAGCAGAGGCTTGG - Intergenic
911297706 1:96137766-96137788 GTGTGAGGACAACTGAGGCAAGG - Intergenic
912470578 1:109904278-109904300 CAGAGAAGAGAACTGAGGCTTGG + Intergenic
914391993 1:147232313-147232335 TTGGGAAGAAAGCTGAGGCAGGG + Intronic
916081122 1:161233033-161233055 CTGAGAAGCCTGCTCAGGCTGGG + Intronic
916580443 1:166102262-166102284 TTGTAAAGACCGTTGAGGCTAGG + Intronic
916679420 1:167090431-167090453 CTGCCAATCCAGCTGAGGCTGGG - Exonic
917290188 1:173464268-173464290 TTGGGAAGAAAGCTGAGGCAGGG + Intergenic
917362513 1:174192615-174192637 CTGTTAAGAAATCAGAGGCTGGG - Intronic
918256355 1:182752194-182752216 CTGACATGACAGCAGAGGCTGGG + Intergenic
919062475 1:192651230-192651252 CTGAGAAGTCAGCTGAGGTGAGG + Intronic
919214294 1:194532737-194532759 CTTTGAAGACAGCAGATACTTGG + Intergenic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
921243911 1:213215932-213215954 TTGTGAAGACCATTGAGGCTAGG + Intronic
921363707 1:214354106-214354128 CTTTGTAGACTGCTGAGGGTGGG - Exonic
922549300 1:226482374-226482396 ATCTGATGACAGCAGAGGCTGGG + Intergenic
923401974 1:233624459-233624481 AGGTGAAGACAGGTGAGGCCAGG - Intronic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
924090316 1:240494257-240494279 CAGTGAAGGAAACTGAGGCTGGG + Intronic
924256117 1:242184661-242184683 GTCAGAAGACAACTGAGGCTGGG - Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1064658858 10:17585104-17585126 CTGTAACAACAGCTGAGTCTTGG + Intergenic
1066234062 10:33468248-33468270 GTGGGAAGGCAGCTAAGGCTCGG - Intergenic
1066613593 10:37275470-37275492 ATGGGGAGGCAGCTGAGGCTCGG + Intronic
1067296784 10:44979202-44979224 GTCTGGAGGCAGCTGAGGCTGGG + Intronic
1067409927 10:46055377-46055399 CTGTAAAGAGAGCAGGGGCTTGG - Intergenic
1067580431 10:47442140-47442162 CTTAGAAGACAGCTGAGCCTTGG - Intergenic
1067659555 10:48224201-48224223 CTGTGAAGAGAGCAGAGGGGTGG - Intronic
1067910013 10:50336783-50336805 CAGTGAAGAAAACTGAGACTTGG - Intronic
1068165853 10:53331790-53331812 ATGTGAAGAAAACTGTGGCTTGG + Intergenic
1068229850 10:54157369-54157391 ATGTGGAAACTGCTGAGGCTTGG + Intronic
1069148253 10:64923276-64923298 CTGTGAAGACATCTGGTCCTGGG - Intergenic
1069368511 10:67718914-67718936 CTGTGAAGACATCTGGTCCTGGG + Intergenic
1069742971 10:70697218-70697240 CAGTGAAGCCAGCTGAGGAGTGG - Intronic
1070324362 10:75378284-75378306 CTGTGAAGCCAGTTGGGGATGGG - Intergenic
1070654478 10:78262028-78262050 CTGTGAGGGCAGCTGAGGATGGG - Intergenic
1070764347 10:79048010-79048032 CACAGGAGACAGCTGAGGCTCGG - Intergenic
1070964320 10:80520398-80520420 CTGTGCGGACAGCCGATGCTGGG - Exonic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072866648 10:99068994-99069016 CAGTAAAGACAGCTGGGACTTGG - Intronic
1073327271 10:102650199-102650221 CTGGGCAGACGGGTGAGGCTTGG - Intronic
1073526683 10:104189594-104189616 CAGTGAAGAAAACTGAGGCTGGG - Intronic
1073610112 10:104934836-104934858 CTGTGAAAACAGTCAAGGCTGGG + Intronic
1076001121 10:126913807-126913829 CTGTCAAAACAGCTCAGGTTAGG + Intronic
1077073251 11:687432-687454 CTGTGAACTGAGCTGAGGCCTGG - Intronic
1078793825 11:14571567-14571589 CTGTGAAGACCATTGATGCTAGG + Intronic
1079482144 11:20892614-20892636 CTGTGAAGACACATGCGGCCGGG + Intronic
1080702002 11:34651811-34651833 CTGTCATCACATCTGAGGCTGGG + Intronic
1080772221 11:35352367-35352389 CTCTGCAGAAAGCTGTGGCTTGG - Intronic
1082136989 11:48560712-48560734 ATGTGAAGTCAGCTAATGCTAGG - Intergenic
1083154314 11:60813373-60813395 CTGTGAAGGTAGCTGATGATAGG - Intergenic
1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084609569 11:70193617-70193639 CTATGGGGGCAGCTGAGGCTGGG + Intergenic
1084947438 11:72646115-72646137 CTGGGAGGAAAGCTGGGGCTGGG - Intronic
1085119622 11:73958748-73958770 CGGGGAAGAAAGCTGAAGCTGGG + Intronic
1085265248 11:75234081-75234103 CTGAGAAGCCAGCTGAGGGGTGG + Intergenic
1085479024 11:76806426-76806448 CTGTGAAGACGGAAGAGGCTGGG + Intergenic
1085978641 11:81694020-81694042 CAGTGAAGGCAGCTGAGGGCGGG - Intergenic
1086439553 11:86814610-86814632 TCATGAAAACAGCTGAGGCTTGG - Intronic
1087774135 11:102242441-102242463 CTGAAAAGTCAGCTGAGGCTGGG + Intergenic
1088802911 11:113322845-113322867 AAGTGAAGACAGGTGAGGATAGG + Intronic
1088881985 11:113979745-113979767 GTGTGGATACATCTGAGGCTTGG + Intronic
1088979586 11:114850096-114850118 ATGTGATGCAAGCTGAGGCTTGG - Intergenic
1089340378 11:117753304-117753326 GTGTGAAAACAGCAGAGGCCTGG + Intronic
1089844158 11:121445456-121445478 CTGTGGGGACAGCAGAAGCTGGG - Intergenic
1090919311 11:131194150-131194172 CTGAGGAGACAGCAAAGGCTGGG - Intergenic
1091196120 11:133732290-133732312 CTGTGTAGACAGCTCTGGATGGG + Intergenic
1091465101 12:677311-677333 CCCTGAAGTCAGCTGAGTCTTGG + Intergenic
1091600400 12:1914499-1914521 CTGTGATGCCAGCGGAGACTTGG - Intronic
1091672472 12:2462198-2462220 CTGTGCAGAGAGCTGAGCCGAGG - Intronic
1091672504 12:2462337-2462359 CTGTGCAGAGAGCTGAGCCAAGG - Intronic
1092016879 12:5166931-5166953 CTATGAAGACACCAGAAGCTTGG - Intergenic
1092112834 12:5976110-5976132 CTGTGAGGACAGCTGTCGGTCGG - Exonic
1092718660 12:11418202-11418224 TTGTAAAGACCACTGAGGCTAGG + Intronic
1095490003 12:42723907-42723929 TTGTGAAGACCACTGAGGCTAGG - Intergenic
1095709832 12:45276383-45276405 CAGTGAAGACATGAGAGGCTGGG - Intronic
1095981805 12:47978437-47978459 CTGAGAGGACAGAAGAGGCTGGG - Intronic
1096182036 12:49556382-49556404 CATTGAAGACGGCTGTGGCTCGG + Exonic
1096433616 12:51569732-51569754 TTGTAAAGACCGCTGAGGCTAGG - Intergenic
1096857888 12:54498251-54498273 CTCTGAAGAGATCTGAAGCTGGG + Intronic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1098026347 12:66206820-66206842 CTGTGAAGCCATCTAAGCCTCGG + Intronic
1100951923 12:99860343-99860365 GAGGGAAGACTGCTGAGGCTGGG + Intronic
1101922981 12:108947884-108947906 CTGTGAAGGCAGATGGTGCTGGG + Intronic
1102078413 12:110078474-110078496 CTGGGAAGCGAGCTGAGGCTGGG + Intergenic
1102207861 12:111102661-111102683 ATGGGGAGAAAGCTGAGGCTTGG + Intronic
1102630784 12:114277421-114277443 CTGTAACAACAGCTGAGTCTTGG + Intergenic
1105543847 13:21337704-21337726 AGGTGAAGACAGATGAGGCTAGG - Intergenic
1105544094 13:21339326-21339348 TGGTGAAGACAGATGAGGCTAGG - Intergenic
1105618884 13:22047851-22047873 CTTTGAAGTCAGCTAAGCCTGGG + Intergenic
1105800760 13:23901314-23901336 CTGTGGAGTCATCTGAGGCCAGG - Intronic
1105848271 13:24311783-24311805 CTGTGGAGTCATCTGAGGCCAGG + Intronic
1108098741 13:46932779-46932801 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1108573052 13:51769117-51769139 CTGTGAAGGCAGCTGACACAGGG - Intronic
1110199987 13:72838676-72838698 CTGTAACAACAGCTGAGTCTGGG - Intronic
1110337258 13:74346748-74346770 CTGGAAAGACAGCTGAAGCCAGG + Intergenic
1110696020 13:78490551-78490573 CTGTAACAACAGCTGAGTCTTGG - Intergenic
1110887764 13:80659293-80659315 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1111144089 13:84157730-84157752 CTGTGCAGACATTTGAGTCTTGG - Intergenic
1111806442 13:93044395-93044417 TTGGGAAGAAAGCTGAGGCAGGG + Intergenic
1112265581 13:97920377-97920399 CTATTAACACAGGTGAGGCTGGG - Intergenic
1112407382 13:99133371-99133393 CTGTCAAGCCAGAGGAGGCTTGG + Intergenic
1112601850 13:100863983-100864005 CTGTGAAGCCATCTGGGCCTGGG + Intergenic
1113968918 13:114173496-114173518 CTGTAACAACAGCTGAGTCTTGG - Intergenic
1114076889 14:19166011-19166033 CTAGGTAGACACCTGAGGCTTGG + Intergenic
1114085271 14:19233557-19233579 CTAGGTAGACACCTGAGGCTTGG - Intergenic
1114538297 14:23436731-23436753 CTCTGGATAAAGCTGAGGCTGGG - Intergenic
1115717495 14:36122519-36122541 TTGTGAAGACCATTGAGGCTAGG - Intergenic
1116871932 14:50075894-50075916 TTGTAAAGACCGTTGAGGCTAGG + Intergenic
1117523629 14:56575700-56575722 TTTTGAAGACAAATGAGGCTGGG - Intronic
1117780382 14:59225589-59225611 TGGTGAGGACACCTGAGGCTAGG + Intronic
1117831398 14:59754870-59754892 CTGTGAAGACAGCATGGCCTTGG - Intronic
1118776127 14:68975161-68975183 TTCTGCAGACAGGTGAGGCTAGG - Intronic
1119346788 14:73931893-73931915 GTGAAAAGACAGCTGAGTCTGGG - Exonic
1120665983 14:87307374-87307396 TTGTCAAGAGAGTTGAGGCTGGG + Intergenic
1121718192 14:96091083-96091105 CTGTGGAGAAAACTGAGGCCAGG + Exonic
1122660820 14:103293760-103293782 GTGTCAGCACAGCTGAGGCTGGG - Intergenic
1124106274 15:26740632-26740654 CTGTCTCCACAGCTGAGGCTTGG + Intronic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1124824377 15:33079324-33079346 TTATAAAGAAAGCTGAGGCTGGG + Intronic
1125037566 15:35143480-35143502 GTGTGAGGAGAGCAGAGGCTGGG + Intergenic
1125700930 15:41682943-41682965 GGGTGAAGAGAGATGAGGCTGGG - Intronic
1125726537 15:41871178-41871200 CTGTGAAGGAAGGTGAGGCTGGG - Intronic
1125731063 15:41893095-41893117 ATGGGAGGACAGGTGAGGCTGGG - Intronic
1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG + Intronic
1127283154 15:57509304-57509326 GAGTGAAAACAGCTGAGGCGTGG - Intronic
1128148560 15:65346757-65346779 CTGTTAAAAGAGCTGAGTCTCGG - Intronic
1129258398 15:74347830-74347852 CTGTGGAGAGGGCAGAGGCTGGG - Intronic
1129310869 15:74708052-74708074 TTGAAAAGACATCTGAGGCTGGG + Intergenic
1130843464 15:87723313-87723335 CTGTGACAACAGGTGAGGGTTGG - Intergenic
1130889832 15:88124337-88124359 CTCTGAGGACAGCTGAGGGGAGG + Intronic
1131138527 15:89958277-89958299 GTGTGAAGGCAGGTGAGGCAAGG - Intergenic
1131911981 15:97216214-97216236 CTTTCAAGGCAGCTGAGACTGGG + Intergenic
1132929453 16:2451433-2451455 CTGTGAGCACAGCTGAGGAGGGG - Intronic
1133206185 16:4235176-4235198 CTAAGAAGACAGGTGAGGCCAGG + Intronic
1133238948 16:4403396-4403418 CTGTGCTGACAGGTGCGGCTTGG + Intronic
1133377561 16:5300614-5300636 CAGTGAAGACATCTGGGACTCGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135224197 16:20641375-20641397 TTGGGAAGAAAGCTGAGGCAGGG + Intronic
1135327859 16:21538709-21538731 CCGATAAGAAAGCTGAGGCTCGG + Intergenic
1135470191 16:22723088-22723110 GTGGGGAGGCAGCTGAGGCTTGG + Intergenic
1137251798 16:46746796-46746818 CGGTGCAGACAGCGGGGGCTAGG + Intronic
1137690936 16:50427061-50427083 CTGTGATCTCATCTGAGGCTCGG + Intergenic
1138472093 16:57245663-57245685 CTTTGCTGACAGCTGAGGGTTGG - Intronic
1139015375 16:62683832-62683854 CTGTGGAGCCAGCAGGGGCTGGG + Intergenic
1139305089 16:65978547-65978569 CTGAGCAGAGAGGTGAGGCTAGG - Intergenic
1139311517 16:66031979-66032001 CTGTGCAGAGAGCTGTGGCTGGG - Intergenic
1139376156 16:66498012-66498034 CTGTAAAGACCACTGAGGCTAGG + Intronic
1139756867 16:69150973-69150995 CTCTGAACACAGCTCACGCTCGG + Intronic
1140198389 16:72874877-72874899 CTATGAAGACAGCAGAAGGTGGG - Intronic
1140521909 16:75588955-75588977 CTGTGAAGCCAGCTGACAGTGGG - Intergenic
1141167499 16:81670119-81670141 CTGTGGAGACAGCAGAGGACAGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141434096 16:83989354-83989376 ATGAGAAGACAGCTAAGGCGTGG - Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1143446755 17:7014444-7014466 CCGTGGAGAGGGCTGAGGCTGGG + Exonic
1143975880 17:10829277-10829299 CAGAGAAGATAGCTGGGGCTGGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144094045 17:11883771-11883793 CTGGGAAGGCAGCCTAGGCTGGG + Intronic
1144381625 17:14704146-14704168 CTGTAACAACAGCTGAGTCTTGG - Intergenic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1146285854 17:31573789-31573811 CAGATAAGAGAGCTGAGGCTGGG + Intronic
1146444844 17:32925492-32925514 CTGTAAAAATAGCTGAGTCTTGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146562111 17:33879161-33879183 CTGTAAAGACTACTGAGGCTAGG + Intronic
1146572185 17:33962275-33962297 CTTTGAGGCCAGCTGAGGCAGGG + Intronic
1146795645 17:35778808-35778830 CTAGGAAAACAGCTGAGCCTGGG - Intronic
1147537130 17:41328277-41328299 CGGTGAAGCCAGCTCAGGCCTGG - Intergenic
1147608864 17:41789696-41789718 CTGTGCAGACAGCTGAGTCTAGG - Intergenic
1148734723 17:49858918-49858940 CAGTGAAGCCAGGGGAGGCTGGG + Intergenic
1149302555 17:55318401-55318423 ATGTGTGGACAGGTGAGGCTGGG + Intronic
1150236162 17:63594518-63594540 CTGTGATCCCAGCTGAGGCATGG + Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151324738 17:73372123-73372145 TTGTGAAGACAGCTGTCCCTGGG - Intronic
1151352696 17:73541155-73541177 CTGTGAGGACAGCTCTGGCTGGG + Intronic
1152489096 17:80616946-80616968 CTGCGCAGTCAGCTGAAGCTTGG - Intronic
1152592401 17:81220146-81220168 CAGTGGACCCAGCTGAGGCTGGG - Intronic
1152928886 17:83100082-83100104 TTATAAAGACAGCGGAGGCTTGG + Intergenic
1153234465 18:2972355-2972377 GTGTGAAGTCAGCCGAGGCAGGG + Intronic
1153504041 18:5777467-5777489 CAGTGAAGCCACCTGGGGCTTGG + Intergenic
1154365788 18:13707743-13707765 CTGTAACAACAGCTGAGTCTTGG + Intronic
1154989493 18:21587369-21587391 CAGTGAAGCCATCTGAGCCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155726260 18:29088015-29088037 CTGTGACGACAGAAGTGGCTAGG + Intergenic
1156425940 18:37012585-37012607 CTGTGTTGACTACTGAGGCTTGG - Intronic
1157945143 18:51970998-51971020 TTGTAAAGACCACTGAGGCTAGG - Intergenic
1158363769 18:56707276-56707298 CAGTAAAGTCAGTTGAGGCTGGG - Intronic
1158922301 18:62206756-62206778 AAGTCATGACAGCTGAGGCTAGG - Intronic
1159612682 18:70544198-70544220 CTTTGAAGACAGCAGATACTTGG + Intergenic
1159914773 18:74178818-74178840 CTGTGAAGATTTCTCAGGCTGGG - Intergenic
1159992183 18:74921673-74921695 CTGTGAAGCCAGGAGAGTCTAGG + Intronic
1160285195 18:77536234-77536256 TTGTAAAGACCACTGAGGCTAGG - Intergenic
1161681082 19:5680188-5680210 CAGAGAAGACAACTGAGGCTCGG + Intronic
1162822191 19:13229704-13229726 CTCTCAAGAGAACTGAGGCTGGG + Intronic
1163901390 19:20103382-20103404 TTGGGAAGAAAGCTGAGGCAGGG - Intronic
1164595147 19:29527200-29527222 CTGTGAATGCAGCTGGGGGTGGG - Exonic
1165407783 19:35641682-35641704 TTGTGACGTCAGCTGACGCTGGG + Intergenic
1166075144 19:40409891-40409913 CAGAGGAGACACCTGAGGCTGGG + Intronic
1166229315 19:41416539-41416561 CTGGGAAGACAGCCAAGGGTGGG - Intronic
1166250305 19:41565108-41565130 CTGGGAGGCCAGCTGTGGCTGGG + Intronic
1167376243 19:49113954-49113976 CTGTGATGAGAGCTGAGAGTGGG - Intergenic
1167468170 19:49661040-49661062 CTGTTATGAATGCTGAGGCTTGG - Intronic
1167736006 19:51294908-51294930 CTCTGAAGAAGGCTGAGGCTGGG - Intergenic
1168075516 19:53979028-53979050 CTAGGAAGACAGATGAGGCCAGG + Intronic
1168075536 19:53979125-53979147 CTAGGAAGACAGATGAGGCCAGG + Intronic
1168158552 19:54492743-54492765 CTGTGCAGATGGCAGAGGCTCGG - Intergenic
1168477685 19:56688962-56688984 CTGTGGAGAGAGCGCAGGCTGGG - Intergenic
1168649712 19:58085443-58085465 CTGTTCCGGCAGCTGAGGCTCGG - Intronic
925532986 2:4884420-4884442 CTGGGGAGGCAGCTGAGGCCCGG - Intergenic
926129202 2:10290347-10290369 CTGTGAGGGCAGCAGAGGCCTGG + Intergenic
926353485 2:12018838-12018860 CTGTAACAACAGCTGAGTCTTGG + Intergenic
926409381 2:12586978-12587000 CTGTGAACTCATCTGAGGCTTGG + Intergenic
926685072 2:15691900-15691922 CTGTGGACACTGCTCAGGCTGGG - Intronic
926782291 2:16484461-16484483 CTATAAACACATCTGAGGCTGGG - Intergenic
926807162 2:16721707-16721729 CTGATAAGGCAACTGAGGCTAGG + Intergenic
926982180 2:18584372-18584394 TGCTGGAGACAGCTGAGGCTGGG + Intronic
927237810 2:20891803-20891825 CAGTGAAGACATCTGATTCTGGG + Intergenic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
928302569 2:30139212-30139234 CTGTAACAACAGCTGAGTCTTGG + Intergenic
928322665 2:30295857-30295879 CTGTGAAGAGTGATGGGGCTGGG - Intronic
928525125 2:32132092-32132114 CTTTTAAGAAAGTTGAGGCTAGG + Intronic
929442957 2:41979810-41979832 CTGAGTAGACAGCAGAGGCATGG + Intergenic
930993334 2:57685942-57685964 CTAAGAAGACAGCTGCAGCTTGG - Intergenic
933415830 2:81985373-81985395 GTGTGGAGGCGGCTGAGGCTGGG - Intergenic
934997642 2:98979857-98979879 TTGTAAAGACCGTTGAGGCTAGG + Intergenic
936167381 2:110134370-110134392 CAGTGAAGCCATCTGATGCTGGG - Intronic
936634912 2:114244916-114244938 CTGGGAAAGCAGCTGGGGCTAGG - Intergenic
937033106 2:118757337-118757359 CTTTAAAGACTGCTGAGGCTGGG + Intergenic
937081156 2:119140942-119140964 CTGTAAAGAAAACTGAAGCTAGG + Intergenic
937596863 2:123683988-123684010 GTGGGAAGGCAGCTAAGGCTTGG - Intergenic
937608186 2:123826890-123826912 GCGTGAAGGCAGCTGAGGCTGGG + Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939777343 2:146403837-146403859 ATGGGAAGGCAGCTAAGGCTCGG + Intergenic
939872526 2:147541180-147541202 CTGTGATCTCATCTGAGGCTTGG - Intergenic
940186810 2:150994319-150994341 CTGTAAAGACAGCAAAGGATTGG - Intergenic
940844903 2:158629854-158629876 CTGTAATCCCAGCTGAGGCTGGG - Intronic
941623779 2:167808390-167808412 CTGTAAAGACCATTGAGGCTAGG - Intergenic
942073076 2:172332725-172332747 CTCTGACGACAGCTGTTGCTGGG + Intergenic
942790515 2:179756020-179756042 TTGTAAAGACCACTGAGGCTGGG - Intronic
943969679 2:194387036-194387058 CTGTAACAACAGCTGAGTCTTGG - Intergenic
945148361 2:206762443-206762465 CTATGAAGGCAGATGAGGATGGG - Intronic
945470871 2:210226325-210226347 TTGGGAAGAAAGCTGAGGCAGGG + Intergenic
947495738 2:230635168-230635190 CTGAGAAGTCACTTGAGGCTAGG + Intergenic
948175846 2:235942171-235942193 CTGTGTAGACAGCTCATGCCAGG + Intronic
1168829773 20:839516-839538 CTGACAAGAAAGCCGAGGCTGGG - Exonic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1170064246 20:12293429-12293451 GAGAGAAGACAGGTGAGGCTTGG + Intergenic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1170336754 20:15278520-15278542 CTTGGAAGACACCTGAGACTAGG - Intronic
1170556504 20:17519079-17519101 CTCTTAAGACTGCTGAGGATGGG + Intronic
1171858278 20:30370415-30370437 CTGTGAAGACAACTGGGGTAAGG + Intergenic
1173311710 20:41902227-41902249 CTGTGAAGAAATCTGAGGGCAGG + Intergenic
1174202759 20:48818841-48818863 CTGTGAAGGCAGCTGCCTCTGGG - Intronic
1174509046 20:51037307-51037329 CTGCGTAAACAGCTGAGTCTTGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174874698 20:54214727-54214749 TTGGGAAGACAGCTGACTCTGGG - Intronic
1175893532 20:62325923-62325945 ATCAGAAGACAGCTCAGGCTGGG + Intronic
1176879043 21:14168769-14168791 TTGTAAAGACCACTGAGGCTAGG + Intronic
1177612153 21:23465670-23465692 CTGTGAAGACACGTGAGCATCGG - Intergenic
1177643671 21:23875846-23875868 CTGTAACGATAGCTGAGTCTTGG - Intergenic
1178182481 21:30178072-30178094 CTTAGAAAACAGCTGAGGCCAGG - Intergenic
1178220710 21:30655845-30655867 CAGTGAAGCCATCTGAGTCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178600341 21:33988972-33988994 CTGACAAGAAAACTGAGGCTGGG - Intergenic
1179384081 21:40925529-40925551 CTGTGAACACAGGTGAGGGGTGG - Intergenic
1179535109 21:42046406-42046428 CTATAAAGAGTGCTGAGGCTGGG + Intergenic
1180292700 22:10859636-10859658 CTAGGTAGACACCTGAGGCTTGG + Intergenic
1180296570 22:10942971-10942993 CTCTGGAGTCAGCTGAGCCTGGG + Intergenic
1180615110 22:17121351-17121373 CGGTGAAGACAGGCGAGGCGGGG + Intronic
1180975529 22:19845790-19845812 GTGTGAACACTGCTGGGGCTGGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1181830272 22:25555038-25555060 GTGTGATGACACCTGAGACTGGG - Intergenic
1182116355 22:27758670-27758692 CAGAGAAGAAAGGTGAGGCTCGG - Intronic
1183949557 22:41345174-41345196 TAGCAAAGACAGCTGAGGCTCGG + Intronic
1184108517 22:42382349-42382371 CAGTCAAGACAGCTCAGGCCAGG - Exonic
1184298287 22:43540001-43540023 CTGAGAAGACGGGTGAGTCTGGG - Intronic
1184580949 22:45417194-45417216 CTATAAAGAAACCTGAGGCTGGG - Intronic
1184799737 22:46752207-46752229 CTTTGCAGGCGGCTGAGGCTGGG + Intergenic
1185188211 22:49415908-49415930 CTGTACAGGCAGCTCAGGCTTGG + Intronic
1185342882 22:50299562-50299584 TTTTGAAAACAGCGGAGGCTGGG - Intronic
950254911 3:11496502-11496524 CTCTGAGGGCTGCTGAGGCTGGG + Intronic
950454874 3:13086699-13086721 CTGTGCAGAGAGCTGAGGGAGGG - Intergenic
950502265 3:13372052-13372074 CTGTGGAGGCAGCTGAGCCCAGG - Intronic
953517703 3:43612402-43612424 CTGGGAAGGAAGCTGAGGCTGGG - Intronic
953666133 3:44927840-44927862 CTGGGAGGACAGCTGAGTCTGGG + Intronic
954440090 3:50516978-50517000 CTGTGGGGAAAGCTGGGGCTGGG + Intergenic
954476016 3:50746574-50746596 CTATAAAGAAATCTGAGGCTGGG + Intronic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
954885623 3:53870740-53870762 CTGTGAAGACCTGTGTGGCTGGG - Intronic
954975753 3:54692640-54692662 GTGTCCAGAGAGCTGAGGCTTGG - Intronic
955506291 3:59636331-59636353 CTGTGACCACAGGTGAGGGTGGG + Intergenic
956025445 3:64978140-64978162 CTCTGAAGACAAATGTGGCTTGG - Intergenic
956126667 3:66017398-66017420 ATCTGAAGAAAGCTGAGGCCAGG - Intronic
956156485 3:66303819-66303841 CTGTGATCTCATCTGAGGCTAGG + Intronic
956186821 3:66570451-66570473 CTGAGAAGCCAGCCTAGGCTAGG + Intergenic
956228923 3:66990830-66990852 CTGAGAAGACAGCTGCATCTTGG + Intergenic
959809052 3:110593994-110594016 CTGTGAAAACAGCTGGGAGTAGG + Intergenic
960367108 3:116785971-116785993 CTGTGTAGTCACCTGAGGATTGG + Intronic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
962699411 3:137981883-137981905 TTGTAAAGACCACTGAGGCTAGG + Intergenic
962754879 3:138459463-138459485 CTTTGCAGTCAGATGAGGCTGGG - Intronic
962815095 3:138990142-138990164 CTGTGATGGCAGCAGAGTCTAGG + Intergenic
963623961 3:147647585-147647607 CTGTAAGCCCAGCTGAGGCTGGG - Intergenic
963969734 3:151416349-151416371 CTGCGAGGACTGCTGGGGCTGGG - Exonic
965435563 3:168646615-168646637 CACTGAAGGCACCTGAGGCTAGG + Intergenic
968481065 4:833304-833326 CTGTGATGGCAGCTCAGGCTGGG + Intergenic
969165091 4:5301374-5301396 CAGTGAAGCCATCTGAGTCTGGG + Intronic
970483201 4:16498558-16498580 CTGTAAGGTAAGCTGAGGCTGGG + Intergenic
970861939 4:20714587-20714609 TTGTAAAGACCACTGAGGCTAGG - Intronic
972436537 4:39040757-39040779 TGGTGAAGAGAGCTGAGGCTGGG + Intergenic
972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975724083 4:77275368-77275390 CTGTCAACTCAGCTGAGGGTTGG + Intronic
976646853 4:87396091-87396113 GTGGGAAGGCAGCTAAGGCTCGG + Intergenic
977343876 4:95793412-95793434 CTGTAAAGACCATTGAGGCTAGG + Intergenic
977630504 4:99237674-99237696 CTGTAAAGACCACTGATGCTAGG - Intergenic
978589643 4:110311050-110311072 CTGTGACAACAGCTAAGTCTTGG - Intergenic
978658777 4:111098727-111098749 TTGTAAAGACCACTGAGGCTAGG - Intergenic
978885567 4:113762354-113762376 CAGTGAACCCTGCTGAGGCTGGG - Intergenic
979150542 4:117308926-117308948 TTGTGAAGATAGCAGAGGTTAGG + Intergenic
979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG + Intronic
979839793 4:125423721-125423743 CTGTGAAGGCAGCTGGGAGTGGG + Intronic
980363215 4:131764817-131764839 CTGTGACCACAGCGGCGGCTCGG - Intergenic
981151097 4:141379821-141379843 TTGTAAAGACCACTGAGGCTAGG + Intergenic
981233387 4:142386526-142386548 CTGTAACAACAGCTGAGTCTTGG + Intronic
981363137 4:143870713-143870735 CTGTGAAAGCAGCCGAGGCGGGG - Intergenic
982731846 4:158964349-158964371 CTGTGAAGTCATCTGAGGCTGGG - Intronic
983108771 4:163723112-163723134 CTGTAAAGACCACTGAGGCTAGG - Intronic
983333808 4:166366713-166366735 TTGTGAATAAAGCTGAGGTTGGG - Intergenic
983477124 4:168227170-168227192 CAGTGAAGCCATCTGAGCCTTGG + Intronic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985546097 5:509955-509977 CTGGGAAGCCAGCTGAGTGTGGG - Intronic
985564262 5:607421-607443 CAGTGAACACAGTTGAGGGTGGG - Intergenic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
986118084 5:4800485-4800507 CTGTGAAGGCAGGTGGAGCTGGG + Intergenic
987902070 5:24025242-24025264 TTTTGAAGACAGCAGATGCTTGG - Intronic
989567073 5:42911216-42911238 CCGTGAACAAACCTGAGGCTGGG - Intergenic
990082104 5:51929631-51929653 CTGTAACAACAGCTGAGTCTTGG + Intergenic
992047916 5:72915328-72915350 CTTTTAAGAGAGGTGAGGCTTGG + Exonic
992546416 5:77818111-77818133 CTTTGAAAATAGCTGAGGCTGGG - Intronic
992631361 5:78683993-78684015 TTGTGAAGACCATTGAGGCTAGG + Intronic
992644970 5:78803463-78803485 CTATGAAGGCCGCTGAAGCTGGG + Intronic
992747621 5:79835125-79835147 CAGGAAAGTCAGCTGAGGCTGGG + Intergenic
992907911 5:81365058-81365080 GTGTGAAGAGCGCTGAAGCTTGG + Intronic
993746754 5:91609260-91609282 CTGTGAAAGCTGCTGAAGCTTGG + Intergenic
994625850 5:102217767-102217789 ATGAGAAGACAGATTAGGCTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995459948 5:112392128-112392150 CTGTAAAGACCACTGATGCTAGG + Intronic
995467346 5:112464822-112464844 CTGTAAAGACCACTGATGCTAGG - Intergenic
995692848 5:114846443-114846465 CTGTAAAGACCATTGAGGCTAGG + Intergenic
995938716 5:117551453-117551475 CTGTGCAGTCAGCTGTGGCCGGG + Intergenic
996442914 5:123512282-123512304 CGGTGGCGACAGCAGAGGCTCGG + Intronic
996474855 5:123905292-123905314 CTGTAACAACAGCTGAGTCTTGG + Intergenic
997197350 5:131988905-131988927 CTGTGGAGACACATGAGGCGGGG + Intronic
997786083 5:136715279-136715301 CTGTGAAAACAGCTGCACCTGGG - Intergenic
997879720 5:137578849-137578871 CTGTGAAGCCTTCTGGGGCTGGG + Intronic
998079264 5:139261148-139261170 CTGTGAAGACAGGGAATGCTTGG - Intronic
998671892 5:144362831-144362853 CTGATAAGGAAGCTGAGGCTGGG - Intronic
999122941 5:149223837-149223859 CTGTAAAGAGGGATGAGGCTAGG + Intronic
999269697 5:150289633-150289655 CTGGGCAGGCAGGTGAGGCTTGG + Intronic
999376773 5:151092224-151092246 ATGTAAAGAGAGCTGAGACTGGG + Intronic
999504520 5:152181050-152181072 CTGTAAAGACATCTGAGACTGGG + Intergenic
999551761 5:152695264-152695286 CTGAGAAGAAAAATGAGGCTGGG - Intergenic
999606591 5:153323594-153323616 CTCTGAAGACAGCTGAAGATAGG - Intergenic
999763246 5:154719037-154719059 CAGAGAAGAAAACTGAGGCTGGG + Intronic
1002327552 5:178419773-178419795 CTGTAACAACAGCTGAGTCTTGG + Intronic
1002876126 6:1211045-1211067 CTTTGAAGCCAGCTGACTCTGGG - Intergenic
1003407997 6:5839077-5839099 AGGTGAGGACAGATGAGGCTAGG + Intergenic
1003502286 6:6712536-6712558 CTCTGCACACAGCAGAGGCTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006046605 6:31304189-31304211 GTGGGAAGTGAGCTGAGGCTTGG + Intronic
1006816001 6:36850405-36850427 GCGTAGAGACAGCTGAGGCTAGG + Intergenic
1006877817 6:37313966-37313988 CTAGGAAGACAGCTGAGGAGAGG - Intronic
1008546572 6:52588864-52588886 CTGGGAAGACAGCCAAGGCCTGG + Intergenic
1009540464 6:64949811-64949833 ATATGAAGGCACCTGAGGCTTGG - Intronic
1009782267 6:68285919-68285941 TTGTAAAGACCACTGAGGCTAGG + Intergenic
1010199294 6:73269018-73269040 GTGGGAAGGCAGCTAAGGCTCGG + Intronic
1010391436 6:75342780-75342802 CTGTGGAAATAGCTGAGGCAGGG - Intronic
1010773651 6:79861211-79861233 CTGTGAAGACAGCAGAGTGAGGG - Intergenic
1010901742 6:81435396-81435418 CTGTAAAGACCACAGAGGCTAGG + Intergenic
1011870072 6:91882038-91882060 CTGGGAAGGCAGCTAAGGCTCGG + Intergenic
1012470902 6:99571309-99571331 CTGTGAAGAAAGCTGAGGCCAGG + Intergenic
1012527316 6:100193677-100193699 TTGTGAAGACAGCTGAACCTAGG - Intergenic
1014022596 6:116608261-116608283 TTGTGAAGACAGCAGAAGTTTGG - Intergenic
1014503400 6:122222731-122222753 CTGGTAAGACAGCAGAGGATGGG - Intergenic
1014700825 6:124685982-124686004 CTGTGTTCTCAGCTGAGGCTTGG + Intronic
1014718578 6:124892189-124892211 GTGGGAAGGCAGCTAAGGCTCGG - Intergenic
1015669429 6:135672076-135672098 ATGTGCAGACAGCTGGGCCTGGG + Intergenic
1015960005 6:138638754-138638776 CTGGGAAGACAGCAGAGGGTTGG - Intronic
1016003429 6:139066162-139066184 AAGTAAAGACAGCTGGGGCTTGG + Intergenic
1016256242 6:142109113-142109135 CTATGAAAACAGCTGAAGCAGGG - Intergenic
1016727281 6:147387906-147387928 CTGGGGAGACAGCTGAGGAAAGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017330102 6:153187488-153187510 CTGTGAAGCCATCTGATCCTGGG - Intergenic
1017558036 6:155594208-155594230 CTGTGAAGAAATCTGAAGCCAGG - Intergenic
1018080669 6:160257059-160257081 ATGTAAAGAAAACTGAGGCTGGG - Intronic
1018386246 6:163305940-163305962 CTGTGATGACATGTGATGCTTGG + Intronic
1018894110 6:168001562-168001584 GTGAGAAGACACCTGAGGCGTGG + Intronic
1018894132 6:168001663-168001685 GTGAGAAGACACCTGAGGCGTGG + Intronic
1018894139 6:168001696-168001718 GTGAGAAGACACCTGAGGCGTGG + Intronic
1018894159 6:168001797-168001819 GTGAGAAGACACCTGAGGCATGG + Intronic
1018894179 6:168001898-168001920 GTGAGAAGACACCTGAGGCGTGG + Intronic
1018894186 6:168001931-168001953 GTGAGAAGACACCTGAGGCGTGG + Intronic
1018894205 6:168002032-168002054 GTGAGAAGACACCTGAGGCATGG + Intronic
1018894225 6:168002133-168002155 GTGAGAAGACACCTGAGGCGTGG + Intronic
1018894232 6:168002166-168002188 GTGAGAAGACACCTGAGGCGTGG + Intronic
1018894267 6:168002335-168002357 GTGAGAAGACACCTGAGGCGTGG + Intronic
1018940421 6:168305999-168306021 CAGTGAAGACAGTGGAGGCAGGG - Intronic
1019049566 6:169172638-169172660 CTGTGAAGTCAGCCCAGGCAAGG + Intergenic
1019191973 6:170256763-170256785 CTGGGAAAACTGCTCAGGCTGGG - Intergenic
1019314523 7:378318-378340 CAGATAAGACAACTGAGGCTCGG - Intergenic
1019501127 7:1365235-1365257 CTGGGAAGGGAGCAGAGGCTTGG - Intergenic
1019506514 7:1394092-1394114 CTGAGCACATAGCTGAGGCTTGG - Intergenic
1020104884 7:5418148-5418170 CTGTGAGGACAACTGAGTCCAGG + Intronic
1020334856 7:7055258-7055280 CTGGGAAGAGAGCTGAGGCAGGG - Intergenic
1020748716 7:12111973-12111995 CTGTGCGCAGAGCTGAGGCTGGG - Intergenic
1021894451 7:25220973-25220995 CTGTGAAGAGAGCAGAGTGTGGG - Intergenic
1023595956 7:41829693-41829715 CTGTGATGGCTTCTGAGGCTTGG - Intergenic
1023927563 7:44681096-44681118 TTGTCAATACTGCTGAGGCTGGG + Intronic
1023931952 7:44711610-44711632 CTGGGAAGATGGGTGAGGCTGGG - Intergenic
1024059588 7:45687830-45687852 CTGTGGAGAGAGCTGTGTCTGGG + Intronic
1024461919 7:49668140-49668162 CTGTGAAGACATCTCAGCCTGGG + Intergenic
1025869412 7:65416786-65416808 CTGTAAAGACCATTGAGGCTAGG + Intergenic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1027496149 7:78889782-78889804 TTGTGAAGACCATTGAGGCTAGG + Intronic
1027845001 7:83361445-83361467 ATGTAAAGCCAGCTAAGGCTAGG - Intergenic
1028030891 7:85911001-85911023 CTGTGAATTCAGCAGATGCTGGG - Intergenic
1028500016 7:91508758-91508780 CTGTAAAGACCATTGAGGCTAGG + Intergenic
1029208447 7:98884604-98884626 CAGTGAGGACAGCTGAGGGCTGG - Intronic
1029542870 7:101194794-101194816 TTAAGAACACAGCTGAGGCTGGG - Intergenic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1030443872 7:109624714-109624736 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1030469018 7:109939400-109939422 CTGTGATGACAGGTGCAGCTTGG + Intergenic
1030549173 7:110936768-110936790 CTGTTAAAACAGCAAAGGCTTGG + Intronic
1032417161 7:131744635-131744657 CTGTGGAGACTGCTGAAGGTTGG - Intergenic
1032914186 7:136469015-136469037 CTGTGAATACATCTGATCCTGGG + Intergenic
1033349634 7:140551606-140551628 CTGTGAGGTCAGCTGGGGTTTGG - Intronic
1034529543 7:151687181-151687203 CAGGGCAGACAGCAGAGGCTGGG - Intronic
1035055028 7:156029350-156029372 CTGAGAAGGCATCTGAGGCCAGG + Intergenic
1036211438 8:6844199-6844221 CATTGATGACACCTGAGGCTAGG - Intergenic
1036623706 8:10446686-10446708 CTGTAACGATAGCTGAGTCTTGG - Intergenic
1036696363 8:10977576-10977598 CAGCCAGGACAGCTGAGGCTGGG + Intronic
1038074619 8:24057703-24057725 ATGAGAAGACAGCTGGGGCCTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1040456677 8:47605167-47605189 CTGAGGAGACAGAGGAGGCTGGG + Intronic
1041061472 8:54038908-54038930 ATGAGAAGACAGCTGAGACGGGG - Intergenic
1042034262 8:64514017-64514039 CTGTAACAACAGCTGAGTCTTGG + Intergenic
1043725978 8:83611304-83611326 GTGGGGAGACAGCTGAGGCCCGG + Intergenic
1043738769 8:83780204-83780226 CTATAAAGACACCTGAGACTGGG - Intergenic
1044023798 8:87142260-87142282 CTGTGAAGAAAAGTGAGGTTGGG + Intronic
1044707007 8:95018581-95018603 CTGAGAAGACAGGTGGGGGTGGG + Intronic
1045393428 8:101737339-101737361 CAGTGAAGACAGTGAAGGCTTGG - Intronic
1046027298 8:108740186-108740208 TTGGGAAGAAAGCTGAGGCAGGG - Intronic
1046898780 8:119501408-119501430 CTGTAACAACAGCTGAGTCTCGG - Intergenic
1047020298 8:120768745-120768767 CAGAGAAGAAAACTGAGGCTCGG - Intronic
1047348584 8:124051933-124051955 CTGTTAGGGGAGCTGAGGCTGGG + Intronic
1048054772 8:130852976-130852998 CTGTGAAGGCTGCTGAGGGGAGG - Intronic
1048098683 8:131323162-131323184 CTGTAAAGACCATTGAGGCTAGG - Intergenic
1048509874 8:135052642-135052664 CTCTGAAGCCAGCTGAGGTTGGG - Intergenic
1049158046 8:141078866-141078888 CTGTGAGGACGGCTGGAGCTGGG - Intergenic
1049513024 8:143039330-143039352 CTGTCAGGGAAGCTGAGGCTGGG - Exonic
1049729808 8:144170638-144170660 CTGTGCTGACATCTGAGGCCTGG - Intronic
1053165632 9:35841821-35841843 CTGTGTAGACATCTGTGGTTGGG + Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1054800417 9:69342799-69342821 TTGTGAAGGCAGCTTAGGCTGGG + Intronic
1055753649 9:79534122-79534144 CTGGGAATACAGCTGTGGATGGG - Intergenic
1056597131 9:88016705-88016727 CCGGCAAGAAAGCTGAGGCTGGG + Intergenic
1057522812 9:95773239-95773261 GTTTGAATTCAGCTGAGGCTGGG - Intergenic
1059283977 9:113157243-113157265 CAGTGAAGACAGCTGCCTCTGGG + Intronic
1059388600 9:113984657-113984679 CTGTGAAGAAAGCCGAGGTAAGG + Intronic
1060407164 9:123378512-123378534 CTGGGAAGTCAGCAGACGCTGGG + Exonic
1060644141 9:125263649-125263671 CCGACAAGAAAGCTGAGGCTGGG - Intronic
1061022780 9:128027005-128027027 ATGTGAACACAGCTGTGTCTGGG - Intergenic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1061339030 9:129963908-129963930 CTGTGAAAAAGGCTGGGGCTGGG - Intronic
1061427752 9:130510852-130510874 CTGAGAAGACAGATGGGGTTTGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186225698 X:7396609-7396631 CTGTGAGGACATCTAGGGCTGGG + Intergenic
1187025616 X:15432997-15433019 CTGTCAAGACAGGTGAGGGTGGG + Intronic
1188189542 X:27157219-27157241 ATGGGAAGGCAGCTAAGGCTTGG - Intergenic
1189343160 X:40219906-40219928 CAGTGGTCACAGCTGAGGCTAGG - Intergenic
1190262026 X:48803205-48803227 CTGGGATGACAGGTGAGGCTGGG + Exonic
1191049995 X:56181551-56181573 CTGTAAAGACCACTGATGCTAGG - Intergenic
1191624177 X:63250965-63250987 CAGTGAAGACAGCTGATTGTGGG - Intergenic
1192200711 X:69064899-69064921 GTGGGAAGCCAGCTGAGTCTTGG + Intergenic
1192241640 X:69335153-69335175 CAGTGAAGTCATCTGAGCCTGGG + Intergenic
1192910610 X:75600586-75600608 TTGTAAAGACAGTCGAGGCTAGG - Intergenic
1193445225 X:81593260-81593282 TTGTAAAGACCACTGAGGCTAGG - Intergenic
1194033393 X:88842665-88842687 TTGGGAAGAAAGCTGAGGCGGGG - Intergenic
1194034049 X:88848796-88848818 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1194908521 X:99609575-99609597 GTGGGAGGACAGCTGAGCCTGGG + Intergenic
1194908580 X:99610191-99610213 CTGTGATCTCATCTGAGGCTCGG + Intergenic
1195294054 X:103458635-103458657 TTGTAAAGACCACTGAGGCTAGG - Intergenic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1195912115 X:109899560-109899582 CTGTAAAGACCATTGAGGCTAGG - Intergenic
1196305425 X:114096702-114096724 TTGTGGAGTCAGCTGAAGCTAGG + Intergenic
1196759657 X:119190011-119190033 CGGTGATGACAGCTGGGGGTGGG + Intergenic
1196793968 X:119488009-119488031 ACGGGAAGACAGCTAAGGCTCGG + Intergenic
1196817670 X:119677935-119677957 CCCTGAAGACACCTGAGGCTGGG + Intronic
1197109759 X:122758288-122758310 CTGTGAAGACTGATTAGGATTGG + Intergenic
1197308821 X:124878712-124878734 CTATAAAGATACCTGAGGCTGGG - Intronic
1198212519 X:134529435-134529457 CAGTTAACACAGCTGAGGATGGG - Intergenic
1198913355 X:141638238-141638260 CTGTGAAAGCAGCTGAGAGTGGG - Intronic
1199791645 X:151160957-151160979 CTGGGAAGTGAGGTGAGGCTGGG - Intergenic
1199856918 X:151766843-151766865 CTGTGGTGAGAGGTGAGGCTGGG + Intergenic
1200356051 X:155552344-155552366 CAGTGAAGGCATCTGAGTCTTGG + Intronic
1200384214 X:155873456-155873478 CTGTGAAGTCAGCTTGCGCTTGG + Intergenic
1200388643 X:155919187-155919209 CAGTGAAGCCAGCTGATTCTGGG + Intronic
1201496923 Y:14598342-14598364 GTGGGAAGGCAGCTGAGGCCTGG + Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201795441 Y:17891578-17891600 TTGTGAAGACCACCGAGGCTAGG + Intergenic
1201806115 Y:18014407-18014429 TTGTGAAGACCACCGAGGCTAGG - Intergenic
1201956734 Y:19632951-19632973 CTGTGAAGACCGTCGAGGCTAGG - Intergenic
1202356869 Y:24060656-24060678 TTGTGAAGACCATTGAGGCTAGG + Intergenic
1202513908 Y:25609458-25609480 TTGTGAAGACCATTGAGGCTAGG - Intergenic