ID: 1072442564

View in Genome Browser
Species Human (GRCh38)
Location 10:95469969-95469991
Sequence GTAGTTCAGTGGTTCTCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 316}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072442564_1072442566 -10 Left 1072442564 10:95469969-95469991 CCTGTCGAGAACCACTGAACTAC 0: 1
1: 0
2: 4
3: 56
4: 316
Right 1072442566 10:95469982-95470004 ACTGAACTACATCCATCTGTAGG No data
1072442564_1072442573 8 Left 1072442564 10:95469969-95469991 CCTGTCGAGAACCACTGAACTAC 0: 1
1: 0
2: 4
3: 56
4: 316
Right 1072442573 10:95470000-95470022 GTAGGGGTACAGGAGATGGGTGG No data
1072442564_1072442571 4 Left 1072442564 10:95469969-95469991 CCTGTCGAGAACCACTGAACTAC 0: 1
1: 0
2: 4
3: 56
4: 316
Right 1072442571 10:95469996-95470018 ATCTGTAGGGGTACAGGAGATGG No data
1072442564_1072442572 5 Left 1072442564 10:95469969-95469991 CCTGTCGAGAACCACTGAACTAC 0: 1
1: 0
2: 4
3: 56
4: 316
Right 1072442572 10:95469997-95470019 TCTGTAGGGGTACAGGAGATGGG No data
1072442564_1072442569 -2 Left 1072442564 10:95469969-95469991 CCTGTCGAGAACCACTGAACTAC 0: 1
1: 0
2: 4
3: 56
4: 316
Right 1072442569 10:95469990-95470012 ACATCCATCTGTAGGGGTACAGG No data
1072442564_1072442567 -9 Left 1072442564 10:95469969-95469991 CCTGTCGAGAACCACTGAACTAC 0: 1
1: 0
2: 4
3: 56
4: 316
Right 1072442567 10:95469983-95470005 CTGAACTACATCCATCTGTAGGG No data
1072442564_1072442568 -8 Left 1072442564 10:95469969-95469991 CCTGTCGAGAACCACTGAACTAC 0: 1
1: 0
2: 4
3: 56
4: 316
Right 1072442568 10:95469984-95470006 TGAACTACATCCATCTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072442564 Original CRISPR GTAGTTCAGTGGTTCTCGAC AGG (reversed) Intronic
900747383 1:4370239-4370261 GTACATTAGTGGTTCTCAACTGG - Intergenic
901102203 1:6727630-6727652 TTAATTCAGTGGCTCTCCACTGG + Intergenic
902173989 1:14635729-14635751 CTAGACCAGTGGTTCTCAACTGG + Intronic
904071570 1:27802596-27802618 ATGGTTCAGTGGTCCTGGACTGG + Intronic
904229114 1:29052352-29052374 TTAGGGCAGTGGTTCTCAACTGG - Intronic
904809398 1:33153384-33153406 CTAGAGCAGTGGTTCTCAACTGG + Intronic
904969421 1:34407435-34407457 GTAGTTCAGAGGTTCTCACAGGG + Intergenic
905039683 1:34945566-34945588 GGAGTTCAGTGGCTATTGACAGG - Intergenic
905798420 1:40828469-40828491 GTAGAGCAGTGGTTCTCAACTGG - Intronic
906792290 1:48669536-48669558 GTAGGAGAGTGGTTCTTGACTGG - Intronic
906926343 1:50121373-50121395 ATAGTTTATTGGGTCTCGACCGG + Intronic
907363690 1:53943388-53943410 GTACTCCAGTGGTTCTCAACTGG + Intronic
907810893 1:57868635-57868657 CTACTGCAGTGGTTCTCAACTGG - Intronic
908181450 1:61610250-61610272 GTATTTCAGTGCATCTCCACAGG - Intergenic
908185005 1:61644055-61644077 CTAGGGCAGTGGTTCTCAACTGG + Intergenic
908661259 1:66437944-66437966 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
909772454 1:79440982-79441004 TTAGTCCAGTGATTCTCAACTGG + Intergenic
913241135 1:116830546-116830568 GAAGGTCAGTGCTTCTCGAATGG + Intergenic
913370020 1:118087991-118088013 CTAGAGCAGTGGTTCTCAACAGG - Intronic
915019945 1:152769679-152769701 CTAATTCAGTGGTTCTCAATGGG - Intronic
915621741 1:157090411-157090433 CTACTTAAGTGGTTCTCCACTGG + Intergenic
916000139 1:160607577-160607599 CTAGATCAGTGGTTCTCAACTGG + Intergenic
916583609 1:166130449-166130471 TTAATGCAGTGGTTCTCAACTGG + Intronic
918333137 1:183479445-183479467 CTAAATCAGTGGTTCTCAACTGG - Intronic
918371947 1:183869889-183869911 GTATGGCAGTGGTTCTCAACAGG + Intronic
918643921 1:186880432-186880454 TTAGTGCAGTGGTTCTAAACTGG + Intronic
918722130 1:187866438-187866460 ATAGTCCAGTGATTCTCAACTGG - Intergenic
921724635 1:218510006-218510028 ATACTTCAGTGGTTTTCCACTGG - Intergenic
922437236 1:225618552-225618574 GTAGTTCACTGATCCTAGACAGG + Intronic
922438654 1:225632200-225632222 GTAGAACAGTGGTTCTCAGCTGG + Intronic
923078603 1:230632561-230632583 CTAGATCAGTGGTTCTCACCTGG - Intergenic
924747424 1:246849063-246849085 GTAGGTCAGAGCTTCTCAACAGG - Intronic
1064460741 10:15532490-15532512 CTAGGTCAGTGGTTCTTAACTGG - Intronic
1064665497 10:17646383-17646405 CTAGTGCAGCGGTTCTCAACTGG - Intronic
1064731426 10:18334761-18334783 GTAACTCAGTGGTTCTCGAATGG - Intronic
1066318444 10:34273909-34273931 CTAGCTCAGTGTTTCTCAACAGG + Intronic
1067361217 10:45581103-45581125 GTAAGTCTGTGGTTCTCAACAGG + Intronic
1067958942 10:50825846-50825868 TTAGGCCAGTGGTTCTCAACTGG + Intronic
1068690605 10:59909951-59909973 CTAGTTCAGTGGTTCCAAACTGG - Intergenic
1069384958 10:67875816-67875838 CTAGATCAGTGGTTCTCAACTGG - Intergenic
1070371879 10:75790311-75790333 CTAGATCAGTAGTTCTCAACTGG - Intronic
1070396821 10:76018385-76018407 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1070526347 10:77299053-77299075 GTAGTTCAGTCGTACTGCACAGG + Intronic
1072256444 10:93625880-93625902 GTAGACCAGTGGTTCTCAACTGG + Intronic
1072337638 10:94413016-94413038 GTATTTCAGTGGTTATAGTCGGG - Intronic
1072442564 10:95469969-95469991 GTAGTTCAGTGGTTCTCGACAGG - Intronic
1073415131 10:103374774-103374796 TTATTGCAGTGGTTCTCAACTGG + Intronic
1075215488 10:120529096-120529118 CTAGGGCAGTGGTTCTCCACTGG + Intronic
1077286084 11:1766609-1766631 GAGGTTCTGTGGTTCTCGGCGGG + Intergenic
1078195479 11:9133512-9133534 GTAGTTCAGTGGGACTTAACGGG - Intronic
1078287691 11:9974444-9974466 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1079363372 11:19788317-19788339 TTACTACAGTGGTTCTCAACTGG - Intronic
1084183156 11:67456478-67456500 GTAGTTCAGGGGGTCACGAGGGG + Intronic
1084206400 11:67596971-67596993 ACAGATCAGTGGTTCTCGAGAGG + Intergenic
1087009643 11:93501137-93501159 CTAGATCAGTGGTACTCAACAGG + Intronic
1087802316 11:102517662-102517684 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1088790151 11:113217784-113217806 GCAGCTCAGTGCTTCTCAACAGG + Intronic
1093146465 12:15572778-15572800 CTAGATCAATGGTTCTCAACTGG + Intronic
1095426365 12:42078455-42078477 CTAGGTCAGTGGTTCTCACCTGG - Intergenic
1098552020 12:71773258-71773280 GTATATCATTGGTTCTCTACCGG + Intronic
1100277295 12:93082714-93082736 ATAGTTCTGTGGTTCTCCACTGG - Intergenic
1101040122 12:100747139-100747161 GTAAGTCAGTGGTTCTCAACTGG - Intronic
1101633420 12:106517308-106517330 CTAGTTCAGTGGTTCTAAACTGG - Intronic
1102427330 12:112854256-112854278 CTAGAGCAGTGGTTCTCAACAGG - Intronic
1102545580 12:113652678-113652700 TTAGATCAGTGGTTCTCAACTGG - Intergenic
1102706720 12:114887521-114887543 TTAGACCAGTGGTTCTCAACTGG + Intergenic
1102841626 12:116131146-116131168 CTTCTTCAGTGGTTCTCAACAGG - Intronic
1102897437 12:116609931-116609953 TTAGAGCAGTGGTTCTCAACAGG - Intergenic
1102941497 12:116946601-116946623 TCAGAACAGTGGTTCTCGACTGG - Intronic
1103129864 12:118458762-118458784 GTAGCCCACTGGTTCTCAACAGG + Intergenic
1103278410 12:119733570-119733592 GTACAGCAGTGGTTCTCAACTGG + Intronic
1103284664 12:119790657-119790679 GCAGACCAGTGGTTCTCAACAGG + Intronic
1104617674 12:130284033-130284055 TTATGTCAGTGGTTCTCCACTGG - Intergenic
1104663629 12:130631608-130631630 GTAGATAAGTGGTTCTCAAAGGG - Intronic
1105529658 13:21207952-21207974 GTAGTTCAGTGGTTATTCAAAGG - Intergenic
1106418133 13:29563113-29563135 GCAGTGCAGTGGCTCTCAACTGG + Intronic
1108567861 13:51719041-51719063 GTAGAACAGTGGTTCTCGTGGGG - Intronic
1109350737 13:61177972-61177994 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
1110462689 13:75763116-75763138 TTAGATCAGTGGTTCTCAACTGG + Intronic
1110663009 13:78080424-78080446 GTAGTTCAGTGGCTATTGACAGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1114141625 14:19918010-19918032 GTAGCACAGTGGTTCTCAACTGG + Intergenic
1115261513 14:31459169-31459191 GTAAGACAGTGGTTCTCAACTGG + Intergenic
1115855563 14:37626132-37626154 TTAGGTCAGTGGTTCTCAATTGG - Intronic
1116572759 14:46538641-46538663 TTACTCCAGTGGTTCTCAACAGG - Intergenic
1118108824 14:62693276-62693298 GTAGATCAGTAGTTCTCAACTGG - Intergenic
1118698538 14:68410203-68410225 GTAGTTCAGTGGTTCTTGGCTGG - Intronic
1119268713 14:73281977-73281999 TTAGTGTAGTGGTTCTCAACTGG - Intronic
1119955089 14:78789319-78789341 CTAGTTAAGGGGTTCTCAACTGG + Intronic
1120492787 14:85197789-85197811 GTAGTTCAATGGTTTGAGACAGG + Intergenic
1121291634 14:92780384-92780406 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1122332337 14:100930713-100930735 GTACCTCAGTGGTTCTCAACTGG - Intergenic
1122572532 14:102716026-102716048 GTAGAGCAGTGGTTCTCAAATGG - Intronic
1124339057 15:28878158-28878180 GTATGTCAGTGGCTCTCAACTGG - Intergenic
1124366526 15:29075550-29075572 TTAGAACAGTGGTTCTCAACTGG - Intronic
1125682517 15:41541049-41541071 CTGGTTCAGTGGTTTTCAACTGG - Intronic
1125895034 15:43294696-43294718 TTATCTCAGTGGTTCTCAACGGG + Intronic
1128570203 15:68728143-68728165 GTAGAACAGTGGTTCTTAACCGG - Intergenic
1129076576 15:73002130-73002152 GGAGTGCAGTGGTTATTGACAGG - Intergenic
1129799567 15:78403815-78403837 ATAATGCAGTGGTTCTCAACTGG + Intergenic
1129945794 15:79538529-79538551 CTAGGGCAGTGGTTCTCAACTGG + Intergenic
1130835865 15:87649447-87649469 CTAGACCAGTGGTTCTCAACTGG + Intergenic
1131305292 15:91237426-91237448 CTAGTGCAGTGGTTGTCAACTGG - Intronic
1131421726 15:92311980-92312002 CTAGTCCAGTGGTTCTTAACTGG + Intergenic
1131548545 15:93336360-93336382 TTAGATCAGTGGCTCTCAACTGG + Intergenic
1131649920 15:94387418-94387440 TTAGGTCAGCGGTTCTTGACTGG - Intronic
1132075814 15:98818835-98818857 CTGGTCCAGTGGTTCTCAACAGG - Intronic
1132277447 15:100581420-100581442 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1133661199 16:7919522-7919544 CTAGACCAGTGGTTCTCAACTGG - Intergenic
1133997212 16:10757613-10757635 GTAAGTCAGTGGCTCTCAACTGG - Intronic
1134135398 16:11673662-11673684 CTTGTTCAGTGGTTCTCAACTGG - Intronic
1134145499 16:11757520-11757542 TTAGCACAGTGGTTCTCAACTGG - Intronic
1134360353 16:13525201-13525223 TTAGCTCAGTGGTTCTCAAAGGG - Intergenic
1134816739 16:17212047-17212069 CTAGAACAGTGGTTCTCAACTGG - Intronic
1135028120 16:19014364-19014386 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1135142431 16:19933121-19933143 ATATAGCAGTGGTTCTCGACTGG + Intergenic
1135187166 16:20325016-20325038 TTAGATCAGTGGTTCTCAACTGG - Intronic
1135597819 16:23756649-23756671 ATAGATCAGTGATTCTCAACTGG + Intronic
1137917807 16:52452068-52452090 GTAGGTTAGTGGTTCTCAACTGG - Intronic
1138090349 16:54168705-54168727 CTAGAGCAGTGGTTCTCAACAGG + Intergenic
1138197178 16:55060330-55060352 CTAGCCCAGTGGTTCTCAACAGG + Intergenic
1139034293 16:62924634-62924656 CTGGTTCAGTGGCTCTCAACTGG + Intergenic
1139553513 16:67690607-67690629 ATAGTTCAGAGGTTCTCAGCTGG - Intronic
1139646170 16:68332394-68332416 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1139892885 16:70265403-70265425 CTAGATCAGTGGTTCTCAAGTGG - Intronic
1140251889 16:73301586-73301608 CTAGGCCAGTGGTTCTCAACTGG - Intergenic
1140930354 16:79622073-79622095 GTAGAGCAGTGGTTCTCAACTGG - Intergenic
1140981161 16:80111112-80111134 GTAGTGCAGTGCTTATCCACAGG + Intergenic
1141065244 16:80908749-80908771 ATAGCTCAGTTGTTCTCAACAGG - Intergenic
1141299155 16:82796852-82796874 GTATTTCAGTGTTTCTCCAACGG + Intronic
1141338323 16:83178359-83178381 CTAAATCAGTGGTTCTCAACTGG - Intronic
1141377311 16:83543607-83543629 CTAAGTCAGTGGTTCTCAACTGG + Intronic
1141737113 16:85861121-85861143 CTAATTCAGTAGTTCTCAACAGG + Intergenic
1144068762 17:11647807-11647829 CTAGATTAGTGGTTCTCAACTGG + Intronic
1144374998 17:14630394-14630416 ATATTTCAGTGGTTCTCAAATGG + Intergenic
1146239796 17:31209200-31209222 GTAATACAGTAGTTCTCAACTGG - Intronic
1147558030 17:41491911-41491933 ATAGTCCAATGGTTCTCAACTGG - Intronic
1148179610 17:45594729-45594751 TTAGTCCCGTGGTTCTCAACTGG - Intergenic
1148269296 17:46251169-46251191 TTAGTCCCGTGGTTCTCAACTGG + Intergenic
1149105307 17:52956554-52956576 GCAGTGCAGTGGTTCTCCAAGGG - Intergenic
1149297122 17:55271097-55271119 CTAGACCAGTGGTTCTCCACCGG - Intronic
1150408359 17:64921250-64921272 GTATTCCAGTGGTTCTCAGCCGG - Intergenic
1150837474 17:68577418-68577440 GTAGACCAGTGGTTCGCCACTGG + Intronic
1150933387 17:69609789-69609811 ATAAATCAGTGGTCCTCGACAGG - Intergenic
1151075858 17:71271855-71271877 CTAGTGCAGTGGTTCTCAGCTGG + Intergenic
1151083029 17:71350321-71350343 GCAGTTCAGTGGTTCTCAAATGG + Intergenic
1151169636 17:72235894-72235916 GTAGAACAGTGGTTCTCAACTGG - Intergenic
1151185751 17:72362778-72362800 CTAAATCAGTGGTTCTCAACTGG + Intergenic
1151327592 17:73388676-73388698 TTAGTACAGTGCTTCTCAACTGG - Intronic
1153423374 18:4934139-4934161 GTAATGCAGTTGTTCTCAACTGG - Intergenic
1153674766 18:7447070-7447092 GAAGCTCAATGGTTCTCAACTGG - Intergenic
1154240867 18:12653060-12653082 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1155952894 18:31932551-31932573 GTAGTTCAGAGATTCAGGACAGG + Intronic
1157367830 18:47082391-47082413 TTAGTCCAGTGGTCCTCAACTGG - Intronic
1157686525 18:49646977-49646999 GTAGAGCAGTTGTTCTCAACTGG - Intergenic
1161305637 19:3565998-3566020 CTAGCTCAGTGGTTCTCATCCGG - Intronic
1161834353 19:6635557-6635579 CGAATTCAGTGGTTCTCAACTGG + Intergenic
1163047583 19:14655817-14655839 ATAGACCAGTGGTTCTCAACGGG + Intronic
1163260479 19:16186739-16186761 GTAGGTCAGTGATTCTCACCTGG + Intronic
1164474524 19:28564949-28564971 GTAAGACAGTGGTTCTCAACTGG - Intergenic
1164789420 19:30963475-30963497 GTAGTTCAGTGGTTGGGGCCTGG - Intergenic
1166175524 19:41066263-41066285 TTAGTTCAGTGTTTCTCAAAAGG + Intergenic
1166579722 19:43884467-43884489 GTAGATCACTGGTTCTGAACAGG + Intronic
1166884363 19:45951009-45951031 TTGATTCAGTGGTTCTGGACAGG + Intronic
1167064438 19:47173720-47173742 ATAATCCAGTGGTTCTCAACTGG - Intronic
1168307593 19:55443744-55443766 GTAAGTCAGTGGTTCTCCACGGG - Intergenic
1168672624 19:58252573-58252595 GTAGTTCAGAGGTTGTCTAAAGG - Intronic
925332316 2:3068125-3068147 TTAATCCAGTGGTTCTCAACTGG - Intergenic
925568546 2:5283913-5283935 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
928227474 2:29464634-29464656 GTAGGGCAGTGGTTCTCAACAGG + Intronic
929370557 2:41219235-41219257 TTAATGCAGTGGTTCTCAACTGG - Intergenic
929519404 2:42633981-42634003 GTAGAACAGTGATTCTCAACCGG + Intronic
931112068 2:59122052-59122074 CTAGGCCAGTGGTTCTCAACTGG + Intergenic
931601300 2:64005753-64005775 CTAACTCAGTGGTTCTCAACCGG - Intronic
931607581 2:64067456-64067478 TTAGATCAGAGGTTCTCAACTGG + Intergenic
931688781 2:64817623-64817645 GAAGTGCAGTGGTTATCCACAGG - Intergenic
932021465 2:68091618-68091640 TTTGATCAGTGGTTCTCAACTGG - Intronic
932489045 2:72106843-72106865 CTAGATCAGTGGTTCTTGATGGG - Intergenic
936937479 2:117852158-117852180 CTAGATCAATGGTTCTCAACTGG + Intergenic
939300416 2:140330147-140330169 GTAGTTCAGTGATGCTAGTCTGG - Intronic
939896124 2:147793181-147793203 TTAGCTCAATGGTTCTCAACTGG - Intergenic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
941766456 2:169302424-169302446 CTAAATCAGTGGTTCTCAACTGG + Intronic
943737523 2:191373201-191373223 CTATTTCAGTGGTTCTCAAATGG + Intronic
944079776 2:195773991-195774013 GTAGTTCAGTGATTCTAGATTGG - Intronic
944213579 2:197231539-197231561 CTAGGCCAGTGCTTCTCGACAGG + Intronic
944514478 2:200498649-200498671 CTAGTGCAGTGGTTCTCAACTGG - Intronic
944543697 2:200778564-200778586 CTAGAACAGTGGTTCTCAACTGG + Intergenic
944693876 2:202183511-202183533 GGAGTGCAGTGGTGCTCCACTGG + Intronic
945259909 2:207833744-207833766 TTAGGTCAGTGGTTCTCAACAGG - Intronic
946880915 2:224176322-224176344 TTAGCTCAGTGGATCTCAACTGG - Intergenic
947374785 2:229484579-229484601 TTAGGTCGGTGGTTCTTGACTGG + Intronic
1170244577 20:14206248-14206270 CTAGATCACTGGTTCTTGACTGG + Intronic
1170849489 20:19991571-19991593 TTACATCAGTGGTTCTCAACTGG - Intronic
1170917431 20:20641120-20641142 GAAGTTAAGTGGTTCTCCATGGG - Intronic
1170934155 20:20795441-20795463 CTAGATCAGTGATTCTCCACTGG - Intergenic
1173447732 20:43135063-43135085 CTAACTCAGTGGTTCTCAACTGG - Intronic
1173906125 20:46631116-46631138 TTAATCCAGTGGTTCTCGACAGG + Intronic
1173968403 20:47131375-47131397 TTAGGGCAGTGGTTCTCGGCAGG - Intronic
1174203077 20:48820614-48820636 TTAGCCCAGTGGTTCTCAACTGG + Intronic
1174204806 20:48830423-48830445 TTACATCAGTGGTTCTCAACAGG - Intergenic
1174622528 20:51887034-51887056 TGAGATCAGTGGTTCTCAACTGG + Intergenic
1174647768 20:52100972-52100994 CTAGTCCAGTGGCTCTCAACTGG + Intronic
1174684187 20:52437850-52437872 CTAGTACAGTGGTTCTCAAGTGG - Intergenic
1174712176 20:52718756-52718778 GTAGTCCAGTGGTTTTTAACTGG + Intergenic
1174754872 20:53148231-53148253 CTAGAACAGTGGTTCTCAACTGG + Intronic
1175417238 20:58809972-58809994 TTATCTCAGTGGTTCTCAACTGG - Intergenic
1175663579 20:60838744-60838766 ACAGTTCAGTGGCTCTCAACTGG - Intergenic
1175792649 20:61751347-61751369 GTAGTTCAGTGGTTCTCAAAAGG - Intronic
1175866009 20:62177100-62177122 GTAGCCCAGTGGTTCTCAAACGG - Intronic
1177888303 21:26773368-26773390 CTAATTCAGTGGTTCTCAACTGG - Intergenic
1178812494 21:35896872-35896894 CTAGTGCAGTGGCTCTCAACTGG + Intronic
1179342023 21:40521086-40521108 GTAGAACAGTGTTTCTCAACCGG + Intronic
1181884914 22:26013174-26013196 CTATGTCAGTGGTTCTCAACTGG + Intronic
1182243698 22:28937689-28937711 CTAGATCAGTGGTTCTCAAAGGG - Intronic
1182779430 22:32855815-32855837 CTAATACAGTGGTTCTCAACTGG - Intronic
1183271302 22:36864240-36864262 CTATCTCAGTGGTTCTCAACAGG + Intronic
1183296233 22:37031115-37031137 CTAGGGCAGTGGTTCTTGACTGG - Intergenic
1183647818 22:39136640-39136662 GTTCTTCAGTGGTTCTAGTCTGG - Intronic
1184227494 22:43137549-43137571 GTAGGACAGTGGTGCTCAACAGG + Intronic
1184665997 22:45989399-45989421 TTAGACCAGTGGTTCTCAACTGG - Intergenic
949343306 3:3052417-3052439 GTAGCTCAGTGGTTTTCAACAGG - Intronic
949620528 3:5806474-5806496 GTAAAGCAGTGGTTCTCAACTGG - Intergenic
951551278 3:23877615-23877637 TTAGAGCAGTGGTTCTCAACTGG - Intronic
951563457 3:23989880-23989902 CTAGTACAGTGGTTCTCAAAGGG + Intergenic
952223926 3:31354109-31354131 CTAGAGCAGTGGTTCTCAACTGG + Intergenic
954198415 3:49009645-49009667 CTAATCCAGTGGTTCTCCACAGG - Intronic
954422928 3:50428090-50428112 TTAGGCCAGTGGTTCTCAACTGG + Intronic
955775557 3:62428759-62428781 GCAGATCAGTGGTTCTCAAATGG + Intronic
955804817 3:62722988-62723010 CTAGATCAGTGGTTCTCAACTGG - Intronic
955867700 3:63402360-63402382 TTAGAGCAGTGGTTCTCAACTGG - Intronic
955981781 3:64534690-64534712 CTAAATCAGTGGTTCTCAACAGG + Intronic
956452718 3:69390362-69390384 CTAGTTCAATGGTTCTCAACCGG + Intronic
956707930 3:72015385-72015407 CTAGTCCAGTGATTCTCAACTGG - Intergenic
958898262 3:99854700-99854722 ATAGATCAGTAGTTCTCAACTGG - Intronic
960705076 3:120473873-120473895 CTAGACCAGTGGTTCTCAACCGG - Intergenic
960724221 3:120653994-120654016 CCAGGTCAGTGGTTCTCAACTGG - Intronic
960875723 3:122293296-122293318 GCAGTTCAGTGGTGGTGGACTGG - Intergenic
961642154 3:128371500-128371522 TTAGACCAGTGGTTCTCAACTGG - Intronic
961661541 3:128471207-128471229 CTAAATCAGTGGTTCTCAACAGG + Intergenic
962034136 3:131632915-131632937 CTAGGTCAGTGGTTCTCCACTGG - Intronic
962792029 3:138820268-138820290 GTAGGTCAGTGTTTCTCATCTGG - Intronic
963574497 3:147042859-147042881 TTAATTCAGTGGTTCTCAATAGG - Intergenic
963756769 3:149242610-149242632 TTAGTACAGTGGTTCTCTACAGG + Intergenic
966012967 3:175104145-175104167 GAAGTGCAGTGGTTCTTGAATGG - Intronic
966825500 3:183961719-183961741 TTAGTTCAGTAGTTCTCTACAGG + Intronic
967671618 3:192242457-192242479 CTACTTCAGTGGTTCTCAACTGG - Intronic
967706426 3:192656458-192656480 CTAGTGCAGTGGTTCTCAGCCGG + Intronic
971723508 4:30277853-30277875 TTCATTCAGTGGTTCTCAACTGG - Intergenic
972761714 4:42112372-42112394 GCAGTTAAGTGGTTCTGAACGGG + Exonic
976466122 4:85370528-85370550 CCAGTTCAGTGGTTCTGAACTGG + Intergenic
976485720 4:85601599-85601621 TTAATACAGTGGTTCTCAACTGG - Intronic
977007627 4:91590991-91591013 TTAGGGCAGTGGTTCTCAACTGG + Intronic
977184009 4:93914566-93914588 TTAGATCAGTGGTTTTCAACTGG - Intergenic
977593536 4:98852672-98852694 CTAAATCAGTGGTTCTCAACTGG - Intergenic
978742420 4:112152173-112152195 CTAAATCAGTGGTTCTCAACTGG + Intronic
979225925 4:118284307-118284329 CTAGGTCAGAGGTTCTCAACTGG - Intronic
979957253 4:126969204-126969226 GTAGAACGGTGGTTCTCAACTGG - Intergenic
982793953 4:159623622-159623644 CTAGCTTAGTGGTTCTCAACTGG - Intergenic
983620314 4:169754687-169754709 CTAGAGCAGTGGTTCTCAACCGG + Intronic
986445037 5:7814300-7814322 TTAGTGCAGTGATTCTCAACTGG + Intronic
986732203 5:10643403-10643425 TTATATCAGTGGTTCTCGATGGG - Intronic
987340194 5:16933147-16933169 CTAGCTCAGTGGATCTCAACTGG + Intronic
988332283 5:29857478-29857500 GAAATTCAGTGGTGCTTGACAGG + Intergenic
988876519 5:35453061-35453083 GTATCCCAGTGGTTCTCAACAGG - Intergenic
988959019 5:36350431-36350453 GTAACCCAGTGGTTCTTGACTGG - Intergenic
990026415 5:51196400-51196422 CTATGTCAGTGGTTCTCAACTGG + Intergenic
990166881 5:53004190-53004212 TTAGTGCAGTGGTGCTCAACTGG - Intronic
990858185 5:60295672-60295694 TTAGCTCAGTGGTTCTCAACTGG - Intronic
991023710 5:62007752-62007774 CTAGATCAGTGTTTCTCAACTGG - Intergenic
991196252 5:63935910-63935932 TTGGATCAGTGGTTCTCAACTGG - Intergenic
991605104 5:68393356-68393378 GTAGAGCAGTGATTCTCAACTGG + Intergenic
992007342 5:72490816-72490838 CAAGTTCAGTAGTTCTCAACTGG - Intronic
992028556 5:72696589-72696611 CTAGGTCAGTGGTTCTCAATGGG - Intergenic
992776255 5:80091752-80091774 GTAGCTCTGTGGTTTTCTACAGG + Intergenic
998461213 5:142311495-142311517 GTCCCTCAGTGGCTCTCGACTGG + Exonic
998573327 5:143285303-143285325 ATAGATCAGTGGTTCTCAAAAGG + Intronic
998880149 5:146637253-146637275 CTAGATCAGTGGTTCTCAACTGG + Intronic
999783862 5:154873786-154873808 CTAGGTCAGTGATTCTCAACTGG + Intronic
999840668 5:155422384-155422406 CTAGATCAGTTGTTCTCAACAGG - Intergenic
999930131 5:156422848-156422870 TTACATCAGTGGTTCTCAACTGG - Intronic
1000124169 5:158227161-158227183 GTAGATCAGTGGTTTTCAACTGG + Intergenic
1000398660 5:160802374-160802396 CTATATCAGTGGTTCTCAACTGG + Intronic
1000577391 5:162991183-162991205 CTAGATCAGTGGTTTTCAACTGG + Intergenic
1000904850 5:166952667-166952689 ATAGAGCAGTGGTTCTCAACTGG - Intergenic
1001058778 5:168470865-168470887 ATAGTTCAGTGGGTCTAGAGAGG - Intronic
1002720045 5:181253478-181253500 CTACATCAGTGGTTCTCAACTGG + Intergenic
1003034106 6:2628219-2628241 TTAAGTCAGTGGTTCTCAACTGG + Intronic
1003402356 6:5800952-5800974 GTAGTTCAGTGGTTATTCAGAGG + Intergenic
1004925984 6:20415567-20415589 CTAGTTCGGTGGTTCTCAGCTGG - Intronic
1004927407 6:20428946-20428968 GTAGACCAGTGGTTCTCAACTGG + Intronic
1007119424 6:39367833-39367855 TTGGTTCAATGGTTCTCAACTGG + Intronic
1008129673 6:47706487-47706509 ATAGGACAGTGGTTCTCAACTGG + Intronic
1008418235 6:51267876-51267898 CTAGTTCAGTGGTTCTGAATTGG - Intergenic
1008574311 6:52845269-52845291 GTAGTCCCATGGTTCTCAACTGG + Intronic
1008762403 6:54868386-54868408 CAAGTTCAGTGGTTCTCAAAAGG - Intronic
1011552817 6:88545492-88545514 CTAGCTCAGTGGTTCTCAACAGG + Intergenic
1011574753 6:88783866-88783888 TTAGATCAGTGATTCTCAACTGG - Intronic
1011776023 6:90731483-90731505 CTAACTCAGTGGTTCTCAACTGG - Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1013109944 6:107056918-107056940 CTAATGCAGTGGTTCTCAACTGG - Intergenic
1013295551 6:108755412-108755434 GTAGTTCAGTGATTATTCACAGG + Intergenic
1014119769 6:117711503-117711525 CTAGTGCAGTGGTTCTCACCTGG + Intergenic
1015458866 6:133464837-133464859 GAATTTCAGTGGTTCACAACAGG + Exonic
1016673083 6:146731176-146731198 GTAGGTGAGTAGTTCTCAACTGG - Intronic
1016953104 6:149600142-149600164 GTAGTGCAGTGGTTATTCACAGG - Intronic
1018047052 6:159974792-159974814 GTAGGCCAGTGGTTCTCAATTGG - Intronic
1018431808 6:163728820-163728842 CTAGCCCAGTGGTTCTCAACTGG + Intergenic
1021248602 7:18295720-18295742 GTAGACCAGTAGTTCTCAACCGG + Intronic
1021799254 7:24287589-24287611 CTAAATCAGTGGTTCTCAACTGG + Intronic
1021882576 7:25108851-25108873 GTAGCCCAGTGGTTCTCAACTGG - Intergenic
1022331748 7:29385717-29385739 TTAGGCCAGTGGTTCTCAACTGG - Intronic
1022626330 7:32040516-32040538 CTAAGCCAGTGGTTCTCGACTGG - Intronic
1023082423 7:36537886-36537908 CTAGGCCAGTGGTTCTCAACTGG - Intronic
1023555263 7:41415614-41415636 GCAGTTCTGTGGGTCTAGACTGG + Intergenic
1024924551 7:54599329-54599351 TTAGAGCAGTGGTTCTCAACTGG + Intergenic
1026065972 7:67073175-67073197 TTAAATCAGTGGTTCTCAACTGG + Intronic
1027546505 7:79533319-79533341 CTAGTTCTGTGGTTCTCAATTGG - Intergenic
1028064399 7:86364102-86364124 GCAGAGCAGTGGTTCTCAACTGG + Intergenic
1030266008 7:107622642-107622664 GTAAATCAGTAGTTCTCAACAGG + Exonic
1031498525 7:122482233-122482255 GTAATTCTGTGGTTCTCAACTGG + Intronic
1032587261 7:133158396-133158418 GGAGTGCAGTGGTTCTTCACAGG - Intergenic
1033166711 7:139045249-139045271 CTAGTTCAGTGGTTTTCAATGGG - Exonic
1033788409 7:144762198-144762220 GTAGGTTAGTTATTCTCGACTGG - Intronic
1035217475 7:157379524-157379546 GGAGTGCAGTGGCTGTCGACAGG + Intronic
1036188453 8:6646816-6646838 TTAGGTCAATGGTTCTCAACTGG - Intergenic
1036616101 8:10388947-10388969 CTAGTTCAGTGATTCTCAACTGG - Intronic
1036616314 8:10390380-10390402 CTAGGTCAGTGGTTCTCAACTGG - Intronic
1037536151 8:19826692-19826714 CTAAGTCAGTGGTTCTCCACTGG + Intronic
1037853224 8:22349957-22349979 TTAGTGAAGTGGTTCTCAACTGG + Intronic
1038159008 8:25019019-25019041 TTAGCCCAGTGGTTCTCAACAGG - Intergenic
1038624412 8:29177043-29177065 TTAGACCAGTGGTTCTCAACTGG + Intronic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1043210313 8:77505853-77505875 GAAGTTCAGTGGTTGTTGGCAGG - Intergenic
1043531512 8:81156459-81156481 GTTGCACAGTGGTTCTCAACTGG + Intergenic
1044919155 8:97149485-97149507 GCAGTTCATTGGTTCCCCACAGG + Intronic
1045576890 8:103432251-103432273 GTAATTCAGTGTTTCTCAATGGG - Intronic
1048357764 8:133667478-133667500 GGAGCTCAGTCGTTCTCCACGGG + Intergenic
1049928713 9:434999-435021 TTAGAGCAGTGGTTCTCAACTGG + Intronic
1050844696 9:10200290-10200312 ATAGATCAGTGGTTTTCAACTGG + Intronic
1051235696 9:14996289-14996311 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
1052303883 9:26983380-26983402 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1053052477 9:34973120-34973142 CTAGCTCAGAGGTTCTCTACCGG - Intronic
1053192358 9:36083124-36083146 ATAGTCCAGTGGTTCTCCACAGG - Intronic
1054778685 9:69146655-69146677 TTAGGTCAGTGGTTGTCAACGGG + Intronic
1054897534 9:70330366-70330388 TTAGACCAGTGGTTCTCAACTGG - Intronic
1056261287 9:84851199-84851221 CTAGGTCAGTGGTTCTCAAACGG - Intronic
1056370316 9:85947555-85947577 TTAGATTAGTGGTTCTCAACTGG + Intronic
1058257576 9:102787969-102787991 GTAACTCAGTGGTTCTCAGCTGG - Intergenic
1058428324 9:104895539-104895561 CTAGAGCAGTGGTTCTCGACCGG - Intronic
1058730519 9:107845674-107845696 GGAGTTCAGTGGCTATCCACAGG + Intergenic
1059148563 9:111925600-111925622 CTAGGTCAGTGCTTCTCAACTGG - Intronic
1059512938 9:114865953-114865975 GTTGTTCAGTGGCTCTTAACTGG + Intergenic
1060955340 9:127634881-127634903 CTAGTCCAGTGGTTCTCAACAGG - Intronic
1185636772 X:1558768-1558790 GTATTAAAGTGGTTCTCAACTGG + Intergenic
1186601284 X:11040495-11040517 CTAGCTCAGTGGTTCTCAACTGG + Intergenic
1186617596 X:11205427-11205449 GCAGGTCAGTTGTTCTCAACTGG - Intronic
1186620803 X:11238051-11238073 ATAGACCAGTGGTTCTCAACTGG - Intronic
1186762935 X:12742149-12742171 TTAGCCCAGTGGTTCTCAACTGG + Intergenic
1186821993 X:13298330-13298352 ATAGATCAGTGGTTCTCAACTGG - Intergenic
1186888917 X:13941016-13941038 CTAGTTCAGGGGTTCTTGACTGG + Intergenic
1186979304 X:14941857-14941879 GTGGTCCAGTGATTCTCAACTGG + Intergenic
1187007168 X:15243828-15243850 CTAGTTCAGTGGTTCTCCACTGG - Intronic
1187029521 X:15471326-15471348 CTATGTCAGTGGTTCTCAACTGG - Intronic
1187040879 X:15594500-15594522 TTATGTCAGTGGTTCTCAACTGG - Intronic
1187753237 X:22490765-22490787 GTAAGTCAGTGGTTCTCAAAGGG + Intergenic
1187978472 X:24729386-24729408 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1188535262 X:31190076-31190098 CTAGGTCGGTGGTTCTCAACCGG + Intronic
1192258758 X:69490147-69490169 ATAAGTCAGTGGTTCTCAACTGG + Intergenic
1195641666 X:107182374-107182396 CTAGTTCAGTAGTTCTCAGCTGG - Intronic
1197114348 X:122815288-122815310 GTCTTTCAGTGGTTCTCAGCTGG + Intergenic
1197199601 X:123736471-123736493 GTAGCTCAGTGGTTCTCAAAAGG - Intergenic
1198318160 X:135490431-135490453 CTGGTTCAGTGATTCTCAACTGG + Intergenic
1198675112 X:139123072-139123094 TTAGGGCAGTGGTTCTCAACGGG - Intronic
1199923537 X:152436477-152436499 ATAATTCAGTGGTTCCCAACTGG - Intronic
1200337503 X:155365750-155365772 GTTGTGCAGTGGCTCTTGACCGG + Intergenic
1200348967 X:155475477-155475499 GTTGTGCAGTGGCTCTTGACCGG - Intergenic