ID: 1072450227

View in Genome Browser
Species Human (GRCh38)
Location 10:95533851-95533873
Sequence GGATAAGAGATAGCCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 340}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072450227_1072450234 11 Left 1072450227 10:95533851-95533873 CCTGGCCTGGCTATCTCTTATCC 0: 1
1: 0
2: 4
3: 21
4: 340
Right 1072450234 10:95533885-95533907 CCCCCTGTGGCACCAGGAAATGG No data
1072450227_1072450240 24 Left 1072450227 10:95533851-95533873 CCTGGCCTGGCTATCTCTTATCC 0: 1
1: 0
2: 4
3: 21
4: 340
Right 1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG No data
1072450227_1072450231 -2 Left 1072450227 10:95533851-95533873 CCTGGCCTGGCTATCTCTTATCC 0: 1
1: 0
2: 4
3: 21
4: 340
Right 1072450231 10:95533872-95533894 CCTGGACAGATCACCCCCTGTGG No data
1072450227_1072450238 17 Left 1072450227 10:95533851-95533873 CCTGGCCTGGCTATCTCTTATCC 0: 1
1: 0
2: 4
3: 21
4: 340
Right 1072450238 10:95533891-95533913 GTGGCACCAGGAAATGGCAAAGG No data
1072450227_1072450232 5 Left 1072450227 10:95533851-95533873 CCTGGCCTGGCTATCTCTTATCC 0: 1
1: 0
2: 4
3: 21
4: 340
Right 1072450232 10:95533879-95533901 AGATCACCCCCTGTGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072450227 Original CRISPR GGATAAGAGATAGCCAGGCC AGG (reversed) Intronic
900032432 1:381218-381240 GGAGAGGAGATGCCCAGGCCAGG + Intergenic
900032448 1:381286-381308 GGAGAGGAGATGCCCAGGCCAGG + Intergenic
900032464 1:381354-381376 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900032480 1:381422-381444 GGAGAGGAGATGCCCAGGCCAGG + Intergenic
900032496 1:381490-381512 GGAGAGGAGATGCCCAGGCCAGG + Intergenic
900032512 1:381558-381580 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900032528 1:381626-381648 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900052982 1:609404-609426 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900052998 1:609472-609494 GGAGAGGAGATGCCCAGGCCAGG + Intergenic
900053014 1:609540-609562 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053030 1:609608-609630 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053044 1:609672-609694 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053060 1:609740-609762 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053076 1:609808-609830 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053092 1:609876-609898 GGAGAGGAGATGCCCAGGCCAGG + Intergenic
900053108 1:609944-609966 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053124 1:610012-610034 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053140 1:610080-610102 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053154 1:610144-610166 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053170 1:610212-610234 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053186 1:610280-610302 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053202 1:610348-610370 GGAGAGGAGATGCCCAGGCCAGG + Intergenic
900053218 1:610416-610438 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053234 1:610484-610506 GGAGAGGAGATGCCCAGGCCAGG + Intergenic
900053250 1:610552-610574 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
900053266 1:610620-610642 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
902278553 1:15357670-15357692 GGATAAGAGATGCCCAGGACAGG + Intronic
902415094 1:16233769-16233791 GGCAAAGAGAGAGCCAGGCAGGG + Intronic
902564837 1:17304604-17304626 GCAAAAGAAACAGCCAGGCCGGG + Intergenic
902664026 1:17924975-17924997 GGTGGAGAGATAGCCAGACCAGG + Intergenic
902921843 1:19670757-19670779 GGAAAACAGAAAGACAGGCCAGG - Intronic
904046590 1:27612904-27612926 GGATCAGACATAGCCTGTCCGGG - Exonic
907305502 1:53510812-53510834 GGAGGAGAGATGGCCAGGGCTGG - Intronic
908248024 1:62243217-62243239 GGATCAGGGAGAGCCAGGCCAGG - Intronic
909322985 1:74313331-74313353 GCACAGGAGATAGACAGGCCTGG - Intronic
911185715 1:94902542-94902564 GTATCAGAGCTATCCAGGCCTGG + Intronic
911366689 1:96947088-96947110 AGATAACAGATATCCAGGCTGGG - Intergenic
913198356 1:116476166-116476188 GGATGAGGGATGCCCAGGCCTGG - Intergenic
918048711 1:180956283-180956305 GGACAAGACAAAGGCAGGCCCGG - Intergenic
919990692 1:202707315-202707337 GGCTAGGAGATAGACAGGCCTGG - Intronic
920416912 1:205805087-205805109 GGATAAGAGACAGACAGGCAAGG + Intronic
920795330 1:209131357-209131379 CCATAAGAGATAGCCTGGCAGGG - Intergenic
921194123 1:212736313-212736335 AGAAAAGAAATAGCCAGGCGCGG - Intronic
921338869 1:214114544-214114566 GGAGAAGAGCTCGCCAGGGCGGG + Intergenic
922855455 1:228771428-228771450 GGTAAAGAGAAAGGCAGGCCGGG + Intergenic
923032073 1:230257098-230257120 GCAGAAGAGCTAGACAGGCCCGG + Intronic
924751847 1:246901042-246901064 GAATAAGAGAGAGCATGGCCAGG + Intronic
1066223490 10:33358530-33358552 GGAAAAAAGTTAGCCAGGCATGG - Intergenic
1066277955 10:33887318-33887340 GGCCAAGAGAGAGCCAGGTCTGG - Intergenic
1068001198 10:51336195-51336217 GTATAAAAACTAGCCAGGCCTGG + Intronic
1069656689 10:70094960-70094982 GGAGAAGAGAGAGCAAGCCCTGG + Intronic
1069786705 10:70992888-70992910 GCAAATCAGATAGCCAGGCCAGG - Intergenic
1070887783 10:79920494-79920516 GGAAAAGGGAGAGCCAGGTCTGG + Intergenic
1071684067 10:87736421-87736443 ATATAAAAAATAGCCAGGCCTGG - Intronic
1072450227 10:95533851-95533873 GGATAAGAGATAGCCAGGCCAGG - Intronic
1072803003 10:98406439-98406461 GGATGAAATCTAGCCAGGCCTGG - Intronic
1073019480 10:100430945-100430967 AAATAAGAAATAGCCAGGCATGG + Intergenic
1074442741 10:113493143-113493165 GGAGAAGACAGAGCCAGGGCTGG - Intergenic
1074919020 10:117988377-117988399 GGATGAGAGATAGCGAGGGCAGG + Intergenic
1075657748 10:124173342-124173364 GGATCAGAGAAAGGCAGGCCTGG + Intergenic
1076409723 10:130237500-130237522 AGATTAGAGATTGCCAGGCATGG - Intergenic
1078313507 11:10270837-10270859 GGAAAAAAGTTAGCCAAGCCTGG + Intronic
1078352018 11:10602542-10602564 GGCCAAGAGAGAGCCAGACCTGG + Intronic
1078795181 11:14585182-14585204 GAACAAGAGAAAGCTAGGCCTGG - Intronic
1079021342 11:16911646-16911668 GGATAACAGAGAGCCATGCAGGG + Intronic
1079156970 11:17956938-17956960 GGCCAAGAGAGAGCCAGGCCAGG - Intronic
1081709903 11:45209905-45209927 GAGTAAGAGTTAACCAGGCCAGG + Intronic
1081767365 11:45621048-45621070 GGATAGGAGATACCCATTCCAGG - Intergenic
1083038865 11:59667947-59667969 AGCTAAGAGGTAGCCAGGCAAGG - Intronic
1083175799 11:60949567-60949589 AGAAAAGAGATGGCCAGGGCTGG + Intronic
1084584216 11:70046923-70046945 AAATAAGAATTAGCCAGGCCTGG + Intergenic
1086091999 11:83014250-83014272 GAATAAGAAAGAGCCAGACCAGG + Intronic
1087073593 11:94106588-94106610 TATTAAGAAATAGCCAGGCCTGG - Intronic
1089517247 11:119040974-119040996 AAATAAAAAATAGCCAGGCCCGG - Intergenic
1091610176 12:2000739-2000761 TGAAAAGAGATAACCAGGCCGGG + Intronic
1095625136 12:44305088-44305110 TGAAAGGAGAGAGCCAGGCCTGG + Intronic
1095705762 12:45235482-45235504 GCATAATAGAAATCCAGGCCTGG + Intronic
1098763350 12:74453258-74453280 GGGTTAGAGATCCCCAGGCCAGG - Intergenic
1102548455 12:113673788-113673810 GCCCAAGAGATAACCAGGCCTGG - Intergenic
1102909164 12:116699455-116699477 ATATAAGAGTTAGCCAGGCGTGG + Intergenic
1103183271 12:118933860-118933882 AGATAATAATTAGCCAGGCCTGG + Intergenic
1103300696 12:119924479-119924501 GGAAAAAAAATAGCCAGGCATGG + Intergenic
1103499198 12:121387876-121387898 TGATTAAAGATAGCCAGTCCAGG + Intronic
1103573329 12:121858967-121858989 GGATCAGAGGTCCCCAGGCCTGG - Intronic
1104504993 12:129323529-129323551 TGATTAGAGGTAGCCTGGCCTGG + Intronic
1105041901 12:132967296-132967318 GGAGAAGAGCTACCCAGTCCAGG + Intergenic
1105836150 13:24213558-24213580 GGATAAGAAAGACCCTGGCCGGG - Intronic
1106234058 13:27846514-27846536 GCAAAAGAGTTAGCCAGGCATGG + Intergenic
1107981070 13:45734625-45734647 GGTTGAGAGATAGTCAGCCCAGG - Intergenic
1108004474 13:45933356-45933378 AGATAACAGATAGCCAGGGCTGG + Intergenic
1108231780 13:48351967-48351989 GGATTGAAGATGGCCAGGCCAGG - Intronic
1108679575 13:52768155-52768177 TGATGAGAGATAGCCAGATCAGG - Intergenic
1109063433 13:57651491-57651513 ATATAAAAGTTAGCCAGGCCTGG - Intronic
1110395251 13:75022776-75022798 AGAAAAGAGATGGCCAGGCACGG + Intergenic
1110451934 13:75646484-75646506 GGAGATGAGATAGGCAAGCCGGG - Intronic
1110826164 13:79974453-79974475 GGAGAAGAGATTGCCTGGGCAGG + Intergenic
1112350388 13:98628319-98628341 AAATAAAAGATAGCCAGGCATGG - Intergenic
1112654055 13:101429934-101429956 GGAGAAAATATAGCAAGGCCTGG + Intergenic
1112662233 13:101523261-101523283 TCATAAGAGAAGGCCAGGCCTGG + Intronic
1113667547 13:112151289-112151311 AGAGAAGAGCCAGCCAGGCCTGG + Intergenic
1114056103 14:18967998-18968020 GCAAAAGAGGTAACCAGGCCTGG + Exonic
1114106448 14:19433755-19433777 GCAAAAGAGGTAACCAGGCCTGG - Exonic
1116756908 14:48959386-48959408 GGATAGGATATAGCCAGAACTGG - Intergenic
1118608686 14:67522738-67522760 GGCTGAGAGACAGCCAAGCCTGG + Intronic
1118798737 14:69169222-69169244 GTATAAAATATAGCCAGGCAGGG - Intergenic
1119257144 14:73208500-73208522 GGATAGGAGATACCCATTCCGGG - Intronic
1122521991 14:102351117-102351139 TAATAAGAGAGAGTCAGGCCTGG - Intronic
1123462756 15:20488656-20488678 AGATAAGAGAGAGAAAGGCCGGG - Intergenic
1123655304 15:22511763-22511785 AGATAAGAGAGAGAAAGGCCGGG + Intergenic
1124156720 15:27232661-27232683 GGATAGGAGACAACAAGGCCTGG + Intronic
1124273445 15:28304657-28304679 AGATAAGAGAGAGAAAGGCCGGG - Intronic
1124309214 15:28606964-28606986 AGATAAGAGAGAGAAAGGCCGGG + Intergenic
1125153147 15:36556494-36556516 GGAAAAAAGACAGCCAGGCGCGG + Intergenic
1126097391 15:45099303-45099325 GAAAAAGAAATAGGCAGGCCGGG - Intronic
1126906751 15:53376125-53376147 GGATAAGCAAGAGCCAGCCCTGG + Intergenic
1126986476 15:54316405-54316427 GACTAAGAGATAGCCAAGCGTGG - Intronic
1128021789 15:64398189-64398211 GAAAAAGAGAAAGCCAGGCACGG - Intronic
1128246598 15:66136875-66136897 GGAAAAAAAATAGCCAGGCATGG + Intronic
1128662833 15:69514739-69514761 GGAACAGAGATAGCCAGGCCAGG - Intergenic
1128662839 15:69514791-69514813 GTAAGAGAGATAGCTAGGCCAGG - Intergenic
1129100066 15:73253214-73253236 GGATGACATATAGCCATGCCTGG - Intronic
1129244950 15:74273622-74273644 GGATAAAAATTAGCCAGGCATGG - Intronic
1132351144 15:101140528-101140550 GGACAGAAGAGAGCCAGGCCTGG + Intergenic
1132838479 16:1966692-1966714 GGATCACAGGTAGCCAGGCGCGG - Intergenic
1134798727 16:17065228-17065250 AGATAAGAGAAAAACAGGCCAGG + Intergenic
1135828634 16:25753651-25753673 GGATTAGAGCCAGACAGGCCTGG - Intronic
1136164450 16:28443735-28443757 AGATAACTGATAGCCAGGCATGG + Intergenic
1136198516 16:28671245-28671267 AGATAACTGATAGCCAGGCATGG - Intergenic
1136214862 16:28785421-28785443 AGATAACTGATAGCCAGGCATGG - Intergenic
1136259586 16:29065266-29065288 AGATAACTGATAGCCAGGCATGG - Intergenic
1136504612 16:30694985-30695007 AAATAAAAAATAGCCAGGCCTGG + Intergenic
1137934092 16:52617223-52617245 GAAAAAGAAAAAGCCAGGCCTGG + Intergenic
1142342644 16:89533841-89533863 GTAAAATAGATAGCCAGGCTTGG + Intronic
1142879596 17:2874069-2874091 GAAAATGAGAAAGCCAGGCCAGG - Intronic
1143829771 17:9641846-9641868 GGATAGGAAAAAGCCAAGCCTGG + Intronic
1144458039 17:15434895-15434917 GGACAAGAAACAGCCAGGTCTGG - Intergenic
1144822527 17:18085428-18085450 GAAAAAAAGATAGCCAGGCGCGG + Intergenic
1145988140 17:29061286-29061308 GGAGGAAAGAAAGCCAGGCCAGG + Intergenic
1146579463 17:34024056-34024078 GGTTAAGAGTAAGACAGGCCTGG - Intronic
1147436354 17:40418608-40418630 GGAAAAAAAATAGCCAGGCGAGG + Intergenic
1150510195 17:65744056-65744078 TTATAAAAGATAGGCAGGCCGGG - Intronic
1151089593 17:71422712-71422734 GTATAAGAGAAGGCCAGGCACGG + Intergenic
1152097765 17:78281835-78281857 GGCTTAGAGCTAGCCAGGCAGGG - Intergenic
1152947412 17:83205556-83205578 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1152947428 17:83205624-83205646 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1152947444 17:83205692-83205714 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1152947478 17:83205828-83205850 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1154138628 18:11802925-11802947 GGAGAAGAGTGAGCCAGGCTGGG + Intronic
1154978186 18:21479521-21479543 GTATAAAAGTTAGCCAGGCACGG + Intronic
1155252580 18:23966314-23966336 GTATAAGAGATGACCAGGCCAGG + Intergenic
1155339255 18:24797573-24797595 GGAGAAGAGATGGCCAACCCAGG - Intergenic
1158882620 18:61795700-61795722 GGATAAGAGCTACCCAAGTCAGG + Intergenic
1160842187 19:1151103-1151125 GGAAGAGAGAAAGCCAGCCCTGG + Intronic
1163615792 19:18327351-18327373 TTATAAGAGGAAGCCAGGCCAGG + Intergenic
1163855713 19:19700472-19700494 GGATAAGAGTTTACCAGACCAGG - Intergenic
1163871611 19:19825940-19825962 GGATAAGAGTTTACCAGGCTGGG + Intergenic
1164050761 19:21584518-21584540 GGAAAAAAGATAGCTAGGCCGGG - Intergenic
1165155370 19:33783823-33783845 GGCTAGGAGTTAGACAGGCCTGG + Intergenic
1165220266 19:34310577-34310599 GGAGAAGAGGAAGGCAGGCCAGG - Intronic
1165225167 19:34349667-34349689 GGATATGAGAAAGCAAGGTCAGG + Intronic
1165325516 19:35112247-35112269 GGAGAAAAGAGAGCCAGGCAAGG + Intergenic
1165355639 19:35302294-35302316 GGAAATGAGATAGCCAGGACTGG + Intronic
1165855875 19:38879078-38879100 GGTTAAGAGGGGGCCAGGCCCGG + Exonic
1166112770 19:40633076-40633098 GAAAAAGACCTAGCCAGGCCAGG - Intergenic
1166686006 19:44796704-44796726 GGAGAAAAGAAAGCCAGGACAGG - Intronic
926078186 2:9960141-9960163 GTGAAAGAGAAAGCCAGGCCCGG + Intronic
926115640 2:10211433-10211455 ACAGAAGAGATATCCAGGCCAGG + Exonic
926373440 2:12203716-12203738 GGATCACAGAGAGTCAGGCCAGG + Intergenic
927291656 2:21410479-21410501 GGATTTGAGAGAGGCAGGCCTGG - Intergenic
927728465 2:25447802-25447824 GTATAAAAGATAACTAGGCCGGG - Intronic
928720883 2:34119491-34119513 GGATGAGACAGAGGCAGGCCCGG + Intergenic
929394705 2:41509605-41509627 GGAGGAGAGATAGTCAGGGCTGG - Intergenic
933933463 2:87179210-87179232 AGACAAAAGTTAGCCAGGCCTGG - Intergenic
934005678 2:87760905-87760927 GAAAAAGAGAAAGCCAGGCATGG - Intronic
934080381 2:88462680-88462702 GAATAAAAGGTAGCAAGGCCAGG - Intergenic
935110832 2:100092741-100092763 GGATAAGAGTTAGCCAGGCTGGG - Intronic
936124142 2:109772421-109772443 GGATAAGAGTTAGCCAGGCTGGG + Intergenic
936220547 2:110599043-110599065 GGATAAGAGTTAGCCAGGCTGGG - Intergenic
936359651 2:111786235-111786257 AGACAAAAGTTAGCCAGGCCTGG + Intronic
936715135 2:115178149-115178171 TGATAAGTGATAGCCAGTCTTGG + Intronic
937037364 2:118793215-118793237 AGGTAGGAGTTAGCCAGGCCAGG + Intergenic
937284206 2:120739610-120739632 GGACAAGGGGCAGCCAGGCCAGG + Intronic
937504761 2:122524606-122524628 GTATAAGAGATATCCAGGGTTGG + Intergenic
938064315 2:128272877-128272899 GCAGAGGAGAGAGCCAGGCCTGG - Intronic
938286212 2:130119981-130120003 GCAAAAGAGGTAACCAGGCCTGG - Exonic
938336854 2:130508701-130508723 GCAAAAGAGGTAACCAGGCCTGG - Exonic
938352969 2:130611934-130611956 GCAAAAGAGGTAACCAGGCCTGG + Exonic
938429397 2:131218915-131218937 GCAAAAGAGGTAACCAGGCCTGG + Exonic
938474223 2:131592096-131592118 GCAAAAGAGGTAACCAGGCCTGG + Intergenic
938802431 2:134775317-134775339 GGAAATGGGATTGCCAGGCCTGG - Intergenic
938914585 2:135923725-135923747 GAATAAGAATTAGCCAGGCGTGG + Intronic
941789144 2:169532122-169532144 GTATAAAAGACAACCAGGCCAGG + Intronic
941949276 2:171136435-171136457 GGCTAAGAGGTAGCCAGGCAGGG + Intronic
942312045 2:174664926-174664948 AGATAAGAAAGATCCAGGCCTGG - Intronic
946896337 2:224328188-224328210 GGACAAGAGATAACGAGGCAGGG - Intergenic
1169162357 20:3391867-3391889 GGAAAAAAGACAGCCAGGCGTGG - Intronic
1169284351 20:4295465-4295487 GGACAGGAGAGAGCCAGGTCAGG - Intergenic
1169379218 20:5092420-5092442 CGTTAAGAGAAAGGCAGGCCAGG + Intronic
1170851794 20:20011460-20011482 GAAGAAGAAATAGCCAGGCATGG - Intergenic
1172095117 20:32456752-32456774 GGAGAAGGGAGAGCCTGGCCGGG - Intronic
1172221276 20:33276707-33276729 GGGTAAGAGAGAGACAGGGCAGG + Intronic
1172339449 20:34144695-34144717 GTATAAAACTTAGCCAGGCCTGG + Intergenic
1174148561 20:48469573-48469595 GAAAAAGAGAAAGGCAGGCCGGG + Intergenic
1174617874 20:51850282-51850304 TGATAAAAGTTAGCCAGGCGTGG + Intergenic
1175375126 20:58518903-58518925 GGTTATTAGATAACCAGGCCTGG - Intergenic
1175996359 20:62813850-62813872 GGGGAAGACACAGCCAGGCCAGG - Exonic
1176816840 21:13610741-13610763 GGAAAAGAGGTAACCGGGCCTGG + Exonic
1180200414 21:46220731-46220753 AGAGGAGAGGTAGCCAGGCCGGG + Intronic
1180474595 22:15690701-15690723 GCAAAAGAGGTAACCAGGCCTGG + Exonic
1181507025 22:23366100-23366122 GGATAAGCGAGGACCAGGCCAGG - Intergenic
1181929118 22:26385162-26385184 GGTGAAGAGATCACCAGGCCAGG - Intergenic
1182400279 22:30070710-30070732 CAAAAAAAGATAGCCAGGCCTGG + Intergenic
1184827230 22:46960639-46960661 GGACAAAAGATACCCAGTCCAGG + Intronic
1203294193 22_KI270736v1_random:24913-24935 GAAAAAGAAATAGCCAGGCATGG - Intergenic
949483630 3:4517006-4517028 AGAAAAGAGATAGGCAGCCCAGG - Intronic
949502879 3:4699051-4699073 GGATTGGAGATGGTCAGGCCAGG + Intronic
949979968 3:9496216-9496238 AAAAAAGAGATAGCCAGGCATGG + Intergenic
951612990 3:24512420-24512442 TTATAAGATGTAGCCAGGCCAGG + Intergenic
952349362 3:32519465-32519487 CGATAAGAAAAAGTCAGGCCAGG + Intergenic
952427632 3:33191787-33191809 AAATAAGAAATAGCCAGGCATGG + Intronic
952530012 3:34253940-34253962 GGATAAGAGTATTCCAGGCCAGG + Intergenic
953068476 3:39496956-39496978 GTATAAAAATTAGCCAGGCCGGG - Intronic
953253213 3:41265081-41265103 GGACACGAGGTGGCCAGGCCTGG + Intronic
954003382 3:47575128-47575150 GAAAAAGAGATACCCTGGCCGGG + Intronic
956628088 3:71287177-71287199 ATATAAGAAATAGCCAGGCAAGG + Intronic
957928573 3:86847297-86847319 GAATAAGAAATAGCCAGGAAAGG - Intergenic
959255501 3:104006744-104006766 TGATAAGAGATAGAAAGGCGGGG + Intergenic
962465057 3:135650091-135650113 AGAAAAGAGATAACCAGGGCAGG - Intergenic
966365906 3:179187240-179187262 AGATAAGAGAAAGGGAGGCCGGG + Intronic
967228191 3:187312979-187313001 GGACAAGAGATGGCATGGCCTGG - Intergenic
968420970 4:484579-484601 CCATAAGAGATGGCCATGCCTGG - Intronic
969248045 4:5948366-5948388 GAAAGAGAGATAGCCAGGGCTGG + Intronic
969498140 4:7537835-7537857 AAATAAAAAATAGCCAGGCCTGG + Intronic
976109504 4:81656019-81656041 AAAGAAGACATAGCCAGGCCCGG - Intronic
976369785 4:84274179-84274201 GGATAGGAGAGAGTGAGGCCAGG - Intergenic
977401866 4:96542502-96542524 GGATCAGAGAGAGGCAGGCAGGG + Intergenic
979788273 4:124744845-124744867 GAGTAAGAGTTGGCCAGGCCAGG + Intergenic
981843076 4:149134925-149134947 GGAAAAGAGAGCGCCAGTCCTGG - Intergenic
982089976 4:151872049-151872071 GGAAGAGAGATAGCCAAACCTGG + Intergenic
982091164 4:151881033-151881055 GCACAAGAGGAAGCCAGGCCTGG - Intergenic
982091416 4:151883151-151883173 GCACAAGAGGAAGCCAGGCCTGG - Intergenic
982486832 4:155976422-155976444 GAATAAGTGATAGCCAGTCCGGG - Intergenic
983715470 4:170776555-170776577 GGAGAAGAGCTACCCAGTCCAGG + Intergenic
988845837 5:35126932-35126954 AGATAGGAGATGGCCATGCCAGG + Intronic
988978457 5:36539289-36539311 GAAAAACAGATAACCAGGCCGGG + Intergenic
991365995 5:65868639-65868661 GGACAAGAATTAGCCAGGCATGG + Intronic
992842233 5:80707425-80707447 GTATAAGAAACAGCCAGGCCAGG + Intronic
995842989 5:116462329-116462351 GGGTAAGCTATTGCCAGGCCGGG + Intronic
996849127 5:127933058-127933080 GGATAAGAACATGCCAGGCCTGG + Intergenic
997123018 5:131195780-131195802 TGAAAAGAGCTAGCCAGGCCTGG - Intronic
997191046 5:131935958-131935980 GGATAAAAGTTAGCAAGGACAGG - Intronic
997645597 5:135479501-135479523 GGATAGGAAACAGCCTGGCCTGG - Intergenic
999751398 5:154630603-154630625 GGATTAGGGCCAGCCAGGCCTGG + Intergenic
1000840262 5:166209291-166209313 GGACAAGAGTTAGCCAGGTAAGG - Intergenic
1001003574 5:168030199-168030221 GGAAAAGAGATATTCAAGCCAGG - Intronic
1001411148 5:171512883-171512905 GGAGAAGCAGTAGCCAGGCCAGG - Intergenic
1002741292 5:181437242-181437264 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1002741308 5:181437310-181437332 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1002741324 5:181437378-181437400 GGAGAGGAGATGCCCAGGCCAGG - Intergenic
1002741340 5:181437446-181437468 GGAGAGGAGATGCCCAGGCCAGG - Intergenic
1002741356 5:181437514-181437536 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1002741372 5:181437582-181437604 GGAGAGGAGATGCCCAGGCCAGG - Intergenic
1002741388 5:181437650-181437672 GGAGAGGAGATGCCCAGGCCAGG - Intergenic
1003115935 6:3284005-3284027 GGAAGAGAGGAAGCCAGGCCAGG + Intronic
1003169914 6:3712992-3713014 GGATAAGGGACAGCCCTGCCAGG - Intergenic
1003877747 6:10453258-10453280 GAAAAAGAGATGGGCAGGCCAGG + Intergenic
1004498958 6:16191918-16191940 GGATAAGAGGTAGCAAAACCAGG - Intergenic
1005881840 6:30068125-30068147 GGATAAGAGGTAGGGAGGGCTGG + Intronic
1007213447 6:40216747-40216769 GGGCAGGAGATACCCAGGCCTGG + Intergenic
1007343710 6:41210241-41210263 GAATCAGAGATAGGCAGGCCAGG - Intergenic
1007346577 6:41235959-41235981 AGATCAGAGCTAGGCAGGCCAGG + Intronic
1007676081 6:43596191-43596213 GGGTAAGAGCTTGCCAGGCGCGG + Intronic
1007743975 6:44030948-44030970 TGTTAAGAAATAGCCATGCCAGG + Intergenic
1009760060 6:67994023-67994045 AGATAAGTAATAGCCAGGTCAGG + Intergenic
1010475131 6:76277061-76277083 GAATAAAATATAGCCAGGCGTGG - Intergenic
1013694557 6:112687240-112687262 TGATAAGAAGTAGCCATGCCAGG - Intergenic
1013779379 6:113713206-113713228 GCAAAAGAATTAGCCAGGCCTGG - Intergenic
1015275448 6:131379004-131379026 AGATAGGAGATAGGTAGGCCAGG - Intergenic
1015856803 6:137633468-137633490 GGATAAGAGTAATCTAGGCCGGG - Intergenic
1015895582 6:138013456-138013478 GCATAACAGATCCCCAGGCCTGG + Intergenic
1015902487 6:138082375-138082397 GGATAAGAGGAGGCCAGGCACGG - Intergenic
1016039496 6:139417805-139417827 GTAAAAGAAATAGCCAGGCGTGG - Intergenic
1016775246 6:147897787-147897809 ATACAAGAAATAGCCAGGCCTGG + Intergenic
1016892506 6:149020667-149020689 TGATAAATGACAGCCAGGCCTGG + Intronic
1018003436 6:159599452-159599474 AGATCAGAGATAGCCAGGACAGG + Intergenic
1018756287 6:166852564-166852586 GTGAAAGAGAGAGCCAGGCCGGG - Intronic
1019246426 6:170713007-170713029 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1019246442 6:170713075-170713097 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1019246458 6:170713143-170713165 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1019246474 6:170713211-170713233 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1019246490 6:170713279-170713301 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1019246506 6:170713347-170713369 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1019246522 6:170713415-170713437 GGAGAGGAGATGCCCAGGCCAGG - Intergenic
1019322041 7:420213-420235 CCATCAGAGATGGCCAGGCCTGG - Intergenic
1020251825 7:6475269-6475291 AGAAAAGTGATAGCCAGGCAAGG + Intronic
1027152163 7:75740152-75740174 GCAAAAAAGATAGCCAGGCTTGG - Intergenic
1027344023 7:77238710-77238732 AGATAAGAGCTATCCAGGCTGGG - Intronic
1029618173 7:101673004-101673026 GCGTAACAGAAAGCCAGGCCTGG - Intergenic
1031973008 7:128077317-128077339 GGAAGAGAGAGAGCCAGGGCAGG + Intronic
1032092757 7:128919643-128919665 GCATAAGAGATGGCCAGCACAGG + Intergenic
1032179037 7:129659943-129659965 TGATAAGAGATACCCAAGACTGG + Intronic
1033415909 7:141161148-141161170 GCATAAAAGAAATCCAGGCCGGG - Intronic
1035501617 8:94546-94568 GGAGAGGAGATGCCCAGGCCAGG + Intergenic
1035501633 8:94614-94636 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
1035501649 8:94682-94704 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
1035501665 8:94750-94772 GGAGAGGAGATGCCCAGGCCTGG + Intergenic
1037672797 8:21029579-21029601 GAAATAGAGACAGCCAGGCCGGG - Intergenic
1037992602 8:23331336-23331358 GGATAAGAGAGAGCCAGAGGAGG - Intronic
1039214726 8:35257262-35257284 ATATAAGAGATAGCCAGGCTGGG - Intronic
1039460502 8:37739759-37739781 AGATAAGAGAAAGTCTGGCCAGG - Intronic
1039806589 8:41005121-41005143 GGATGAGACAGAGCCAGGCATGG - Intergenic
1041248719 8:55914163-55914185 AAATAAGAGAAAGGCAGGCCAGG + Intronic
1042138457 8:65654870-65654892 GTATAAAAAATTGCCAGGCCAGG - Intronic
1044716398 8:95103713-95103735 GGATAGGAGTGAGCCAGTCCGGG + Intronic
1047475333 8:125222904-125222926 GGAAAAGAAATAGCCAGGTGTGG + Intronic
1048308381 8:133299237-133299259 AGATGAAAGCTAGCCAGGCCTGG + Intronic
1048326391 8:133442518-133442540 GGATAAGAGTTAGCCAAGCACGG - Intergenic
1048735381 8:137493962-137493984 CAATAAGAGATAGCCAGACGAGG + Intergenic
1048852904 8:138661653-138661675 GGAAAAGAGAGAGCCATTCCAGG + Intronic
1049402219 8:142433553-142433575 GGACAAGAGAGAGCCTGGCAGGG + Intergenic
1049458689 8:142709862-142709884 GGATAAAAGACAGCTGGGCCTGG + Intergenic
1049578137 8:143398883-143398905 GTGCAAGAGATAGCCTGGCCCGG + Intergenic
1052171295 9:25400397-25400419 TAATAGGAGATAGCCAGGCATGG + Intergenic
1055756474 9:79563658-79563680 ATATAAAAGTTAGCCAGGCCTGG + Intergenic
1056650508 9:88456434-88456456 GGATCAGAGATAGTAAGGGCTGG + Intronic
1057452332 9:95175807-95175829 GGAAAAGGGAAAGCCCGGCCAGG + Intronic
1058704148 9:107624859-107624881 GGAGAAGAGATTTCCAGGCACGG - Intergenic
1058951226 9:109905827-109905849 GGAGAAGAAACAGTCAGGCCAGG + Intronic
1059303154 9:113331741-113331763 GGATAAGAAACAGTCAGGGCTGG - Intronic
1059330040 9:113529087-113529109 GGAAAAGAGAGAGGCAGGCATGG - Intronic
1059333174 9:113549160-113549182 GGTTTAGAGACAGACAGGCCAGG + Intronic
1059379210 9:113910109-113910131 GGATAAGGGGCAGCCAGGCGGGG - Intronic
1059453033 9:114382754-114382776 GGATAGGAAATATCCAGGCAAGG + Intronic
1060235596 9:121860485-121860507 GGAGGAGAGATAGACAGGACAGG - Intronic
1060773014 9:126346463-126346485 GGAGCAGAGACAGCCAGGTCGGG + Intronic
1061270381 9:129537063-129537085 GGATAAAAATTAGCCAGGCGTGG + Intergenic
1061716408 9:132521125-132521147 GGAGAACAGAGAGCCCGGCCAGG - Intronic
1062192093 9:135253346-135253368 GCACAAGGGAGAGCCAGGCCTGG + Intergenic
1062414649 9:136442138-136442160 GGACAAGTGGTGGCCAGGCCTGG + Intronic
1062705574 9:137938776-137938798 AGATATGAGATAGACAGGCCAGG + Intronic
1062730899 9:138108039-138108061 AAAAAAGAGATAACCAGGCCAGG + Intronic
1203530522 Un_GL000213v1:138753-138775 GGAAAAGAGGTAACCGGGCCTGG - Intergenic
1203607171 Un_KI270748v1:68322-68344 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1203607187 Un_KI270748v1:68390-68412 GGAGAGGAGATGCCCAGGCCAGG - Intergenic
1203607203 Un_KI270748v1:68458-68480 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1203607219 Un_KI270748v1:68526-68548 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1203607235 Un_KI270748v1:68594-68616 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1203607251 Un_KI270748v1:68662-68684 GGAGAGGAGATGCCCAGGCCAGG - Intergenic
1203607267 Un_KI270748v1:68730-68752 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1203607283 Un_KI270748v1:68798-68820 GGAGAGGAGATGCCCAGGCCTGG - Intergenic
1203607299 Un_KI270748v1:68866-68888 GGAGAGGAGATGCCCAGGCCAGG - Intergenic
1203654244 Un_KI270752v1:7951-7973 TGCTAAGAGATGTCCAGGCCAGG - Intergenic
1185611035 X:1393708-1393730 GGAAAAGAGACAGCTAGGCGTGG - Intergenic
1187530333 X:20090814-20090836 GGATAAAACTTAGCCAGGCATGG + Intronic
1189931752 X:46019285-46019307 GAATAAAAGATAGCCATGCTTGG + Intergenic
1190621212 X:52288472-52288494 GGATAAGAGCTACCCACTCCAGG + Intergenic
1191977027 X:66884414-66884436 GGATAAGAGAAACACAGGCAAGG - Intergenic
1194745854 X:97627633-97627655 GGATACCAGATAACAAGGCCAGG + Intergenic
1194858659 X:98966637-98966659 GGACAAGAAATAACCAAGCCTGG + Intergenic
1196727875 X:118913409-118913431 GAATAAGAGTTAGCCAGGTGAGG - Intergenic
1196734361 X:118971860-118971882 GGCTAAGAGAGGGCCAGGTCAGG - Intergenic
1196883105 X:120217810-120217832 GGATTAAAGAAAGCCAGGCATGG + Intergenic
1198068369 X:133122658-133122680 GGAAAAGAGCTATCCAGGGCAGG - Intergenic
1198558248 X:137819238-137819260 ACATAAGAGAGAGCCAGGCGCGG - Intergenic
1199784816 X:151095682-151095704 GTATAAAAATTAGCCAGGCCTGG - Intergenic
1201539921 Y:15094856-15094878 GGATAAAAGATTGCCATGACTGG + Intergenic