ID: 1072450229

View in Genome Browser
Species Human (GRCh38)
Location 10:95533856-95533878
Sequence GTCCAGGATAAGAGATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072450229_1072450234 6 Left 1072450229 10:95533856-95533878 CCTGGCTATCTCTTATCCTGGAC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1072450234 10:95533885-95533907 CCCCCTGTGGCACCAGGAAATGG No data
1072450229_1072450238 12 Left 1072450229 10:95533856-95533878 CCTGGCTATCTCTTATCCTGGAC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1072450238 10:95533891-95533913 GTGGCACCAGGAAATGGCAAAGG No data
1072450229_1072450240 19 Left 1072450229 10:95533856-95533878 CCTGGCTATCTCTTATCCTGGAC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG No data
1072450229_1072450232 0 Left 1072450229 10:95533856-95533878 CCTGGCTATCTCTTATCCTGGAC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1072450232 10:95533879-95533901 AGATCACCCCCTGTGGCACCAGG No data
1072450229_1072450231 -7 Left 1072450229 10:95533856-95533878 CCTGGCTATCTCTTATCCTGGAC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1072450231 10:95533872-95533894 CCTGGACAGATCACCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072450229 Original CRISPR GTCCAGGATAAGAGATAGCC AGG (reversed) Intronic
900620941 1:3587702-3587724 GTGCAGGCTCAGAGATAGCCAGG - Intronic
900782870 1:4629214-4629236 GGCCAGCAGAAGAGAGAGCCTGG - Intergenic
900890169 1:5443904-5443926 GTCCAGGGTCAGAGGAAGCCTGG - Intergenic
901296138 1:8162138-8162160 GTCCAGGAGAGGAGAGAGACCGG - Intergenic
901928396 1:12581643-12581665 GTCAAGGTTAAGAATTAGCCAGG - Intronic
902221456 1:14968515-14968537 GTCCAGGGAAAGAGAGGGCCTGG - Intronic
904682472 1:32239169-32239191 GTCCAGGTGCAGAGACAGCCTGG - Intergenic
904912333 1:33944758-33944780 GCCCCGGGTAAGAGTTAGCCCGG - Intronic
908020992 1:59898438-59898460 GGCCAAGATCAGAGATATCCAGG + Intronic
908741007 1:67327610-67327632 GTCCATGAGAAGAGAGAGTCTGG + Intronic
909772228 1:79438156-79438178 GTCCAGCAAAAGAGATAACAAGG - Intergenic
912529786 1:110312019-110312041 GACCAGGATGAGAGAGAGCTGGG + Intergenic
918413653 1:184285971-184285993 GTCCAGGAGGAGAGGAAGCCAGG + Intergenic
920450839 1:206059977-206059999 GTCCAGAAAAAGAGATAACCAGG - Intronic
920795336 1:209131362-209131384 TTCCCCCATAAGAGATAGCCTGG - Intergenic
922530960 1:226344815-226344837 GTCCAGGAAGAGAGGTAGGCAGG + Intergenic
922864645 1:228849096-228849118 CTCCAGGAGAAGAGCTTGCCTGG + Intergenic
1064316444 10:14262253-14262275 GGCCAAGAGAAGAGATAACCGGG - Intronic
1071478891 10:86048150-86048172 TTCCAGGATCAGAGATCACCAGG + Intronic
1072450229 10:95533856-95533878 GTCCAGGATAAGAGATAGCCAGG - Intronic
1073266071 10:102229277-102229299 GCCCTGGAGAAGAGAGAGCCTGG - Exonic
1079857513 11:25624598-25624620 TTCCAGGATAGTAGACAGCCTGG - Intergenic
1085755437 11:79197768-79197790 GTTCAGGAGGAGAGAAAGCCAGG - Intronic
1090618787 11:128542430-128542452 GTCCAGTAGAAGAGTCAGCCTGG - Intronic
1091043430 11:132303761-132303783 GTCCAGGATGAGAACTAGCATGG + Intronic
1091680356 12:2522562-2522584 TCCCAGGAGAAGAGAAAGCCGGG + Intronic
1093812064 12:23503504-23503526 GTCCACCATTAGATATAGCCTGG + Intergenic
1099717451 12:86314258-86314280 GAGAAGGATAAGAGATAGGCTGG + Intronic
1099885626 12:88526754-88526776 TTCCAGGAATAGAGAAAGCCAGG + Intronic
1100428140 12:94506725-94506747 TTCTTGGAGAAGAGATAGCCTGG - Intergenic
1116225747 14:42149753-42149775 GTATAGGATAAGAGACAGCAAGG + Intergenic
1117500602 14:56347365-56347387 TTCCAGGATAAGAAAGAGCTGGG - Intergenic
1117540898 14:56745694-56745716 GTCCAGGAGGAGAAAGAGCCGGG - Intergenic
1117701669 14:58419999-58420021 GTCCAGGAGTTGAGACAGCCTGG - Intronic
1128239179 15:66089338-66089360 GTGCAGGATAAGTCAAAGCCCGG - Intronic
1132202854 15:99966978-99967000 GTGCAAGATTAGAGATAACCAGG - Intergenic
1136063660 16:27744220-27744242 TGCCAGTATAAGAGAGAGCCTGG + Intronic
1143599470 17:7934744-7934766 CTGCAGGTTAAGAGAAAGCCAGG - Intronic
1149732493 17:58960082-58960104 TTCCAGGATAAGGGATACACAGG + Intronic
1150053259 17:61987045-61987067 GGTCAGTATAAGAGACAGCCAGG + Exonic
1152390624 17:80001801-80001823 GTCCAGGGCAAGAGACAGCAGGG - Intronic
1158221387 18:55154374-55154396 GATGAGGATAAGAGATATCCTGG + Intergenic
1165013348 19:32864230-32864252 GCCCAGGAGAAGAGGTAGGCGGG + Exonic
933119250 2:78515788-78515810 GTCCAGAATAAAAAATAGACTGG + Intergenic
935203033 2:100874850-100874872 TTCTAGGATAGGAGACAGCCTGG - Intronic
937249649 2:120515352-120515374 GTCCAGGAGAAGGGAGAGTCAGG - Intergenic
937249729 2:120515693-120515715 GTCCAGGAGAAGGGAGAGTCAGG - Intergenic
937888672 2:126918031-126918053 GTGCAGGATCAGAGATACCTAGG + Intergenic
938117531 2:128612147-128612169 GGCCAGGAGAGGAGACAGCCCGG - Intergenic
946686757 2:222278628-222278650 GTCTAGGAGGAGACATAGCCAGG - Intronic
1168835926 20:877320-877342 ATCCTGGTTCAGAGATAGCCAGG + Intronic
1171328603 20:24318009-24318031 GTCCAGGGACACAGATAGCCAGG - Intergenic
1172331055 20:34076484-34076506 GATCAGGAGAAAAGATAGCCAGG + Intronic
1172595931 20:36151193-36151215 GTCCAGGATACAGGAAAGCCAGG - Intronic
1173495698 20:43515640-43515662 GTCAAGGTTAAGACATAGTCAGG + Intronic
1178253196 21:31024567-31024589 GTTTAGGATTAGAGGTAGCCTGG + Intergenic
1178360988 21:31948458-31948480 GCCCAGGAACACAGATAGCCAGG - Intronic
1184165766 22:42726719-42726741 GTCCAGGGTCAGAAATAACCAGG - Intergenic
1184905656 22:47484150-47484172 GTGCAAGATTAGAGATAACCAGG + Intronic
951365958 3:21782883-21782905 GTCCAGGATGTGATATAACCAGG - Intronic
951406739 3:22309567-22309589 GTCCAAGATAAAACATGGCCAGG + Intronic
951533770 3:23723342-23723364 GTCCAGGATGACAGATGGACAGG + Intergenic
955081196 3:55659364-55659386 GCCCAGGATGACAGACAGCCAGG - Intronic
957368722 3:79262074-79262096 GTCTTAGATAATAGATAGCCTGG - Intronic
957772149 3:84707848-84707870 GGCCAGGAAAAGAAATAGACGGG + Intergenic
958940290 3:100304716-100304738 GTCAAGGAAATGAGAAAGCCCGG + Intronic
961653083 3:128426886-128426908 GTCCAAGATGAGATATACCCAGG + Intergenic
969249226 4:5956183-5956205 CTCCAGGATTACAGAAAGCCAGG + Intronic
969498841 4:7541027-7541049 GTCCAGGGTAAGAGACAGAAGGG - Intronic
970351133 4:15202807-15202829 TTCCAGGATGAGTGATAGCAAGG - Intergenic
973142467 4:46785705-46785727 GACAAGGATAAAAGAAAGCCTGG + Intronic
978736869 4:112093585-112093607 GTCCAGGACAAGGTTTAGCCAGG - Intergenic
980836715 4:138202891-138202913 GTGCAGGATATGAGTCAGCCTGG - Intronic
982051303 4:151505092-151505114 GTACAGGACAATTGATAGCCTGG - Intronic
982102142 4:151978480-151978502 GTGCAGGGTAAGAGAAAGACAGG - Intergenic
985371496 4:189289916-189289938 GTGCAAGGTCAGAGATAGCCAGG - Intergenic
986250286 5:6050104-6050126 GTCCAGCATAAGGTATATCCTGG + Intergenic
986401880 5:7390031-7390053 GTCCAGGAAAAGAGATTATCTGG - Intergenic
986736975 5:10675116-10675138 GTCGAGGAAAAGAGAAAACCTGG - Intergenic
987339374 5:16925826-16925848 CTTCTGGATAAGAGATAACCAGG - Intronic
989156058 5:38346050-38346072 GTGCAGGAAAAGAGACAGACGGG + Intronic
991365195 5:65860644-65860666 CTCCAGAATCAGAGGTAGCCAGG - Intronic
997186047 5:131883268-131883290 GTCTAGGTTAAGAGAAAACCTGG + Intronic
998330228 5:141319435-141319457 TTCCTGGAGAAGAGATATCCAGG + Exonic
999143182 5:149376344-149376366 GTCCAGCATAAGAGACAGACTGG + Intronic
999172340 5:149606206-149606228 GGCCTGGCTAAGAGATAGCTTGG - Intronic
1004443940 6:15680462-15680484 GTCCAGTAAAAGAGAGATCCAGG - Intergenic
1007629823 6:43266969-43266991 GTGCAGGATCAGAGAGAGCCTGG + Intronic
1010977137 6:82328527-82328549 GGCCAGGATCAGAAATAGCAAGG - Intergenic
1013198376 6:107866221-107866243 GTCCAGGATAAGATCAAGACAGG + Intergenic
1020421189 7:8007129-8007151 GTCCAGGATAAGGGCTTGTCTGG + Intronic
1021305144 7:19022900-19022922 GGCCAGGATAAGATAAGGCCAGG + Intronic
1024840720 7:53584318-53584340 ATCAAGGATAAGATATATCCTGG - Intergenic
1027676271 7:81162376-81162398 GTGCAACATAAGAGATAACCAGG - Intergenic
1029171483 7:98632256-98632278 GTTCAAGAGAAGAAATAGCCAGG + Intergenic
1035642863 8:1197279-1197301 GACAGGGATAAGTGATAGCCAGG - Intergenic
1035779326 8:2215491-2215513 GACACGGAGAAGAGATAGCCAGG + Intergenic
1035867196 8:3097595-3097617 GTCCTGGGTGAGACATAGCCCGG + Intronic
1041819217 8:62010523-62010545 GCCCAGGAGAAGAGCTAGGCTGG + Intergenic
1044773121 8:95658718-95658740 GTCCAGGAAAATAAAAAGCCTGG - Intergenic
1048074249 8:131051999-131052021 GTGGAGGAAAAGAGGTAGCCTGG + Intergenic
1049414256 8:142488156-142488178 GTCCAGGAGCAGAGACAGCAAGG - Intronic
1050231125 9:3526526-3526548 GTCCAGGAAAAGGAAAAGCCAGG - Intergenic
1052796119 9:32925012-32925034 TTCCAGGCTTAGAGATGGCCTGG - Intergenic
1053885860 9:42644821-42644843 GGACTGGATAAGAGAAAGCCTGG + Intergenic
1054224878 9:62452270-62452292 GGACTGGATAAGAGAAAGCCTGG + Intergenic
1055930076 9:81551132-81551154 GTCAAGCATAAGAAATAGGCAGG + Intergenic
1056800611 9:89688166-89688188 GGCCTGGAAAAGAGATATCCAGG + Intergenic
1059139261 9:111836411-111836433 CTCCAGGAAAAGAAACAGCCAGG - Intergenic
1061787399 9:133038231-133038253 GTCCCGGATATTAGATATCCAGG - Intronic
1061926769 9:133809746-133809768 GGACAGGATTAGAGATTGCCTGG + Intronic
1187178895 X:16924042-16924064 ATCCAGGCTAAGAGAGAGGCAGG + Intergenic
1190931212 X:54950898-54950920 GGCCAGGATGAGACAGAGCCAGG - Intronic
1190951387 X:55147372-55147394 GTGCAGGAAAAGAGATAGAAGGG + Intronic
1192044179 X:67654636-67654658 GTCCAGGAGAAAAGCTAGCAAGG + Intronic
1197329802 X:125139569-125139591 GTCCAGAATAAGAGATGGCTAGG + Intergenic
1201633316 Y:16094096-16094118 GTGCAAGGTCAGAGATAGCCAGG - Intergenic