ID: 1072450230

View in Genome Browser
Species Human (GRCh38)
Location 10:95533872-95533894
Sequence CCACAGGGGGTGATCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072450230_1072450241 29 Left 1072450230 10:95533872-95533894 CCTGGACAGATCACCCCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1072450241 10:95533924-95533946 TATTAGAAGAAGATAAAAGAAGG No data
1072450230_1072450234 -10 Left 1072450230 10:95533872-95533894 CCTGGACAGATCACCCCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1072450234 10:95533885-95533907 CCCCCTGTGGCACCAGGAAATGG No data
1072450230_1072450240 3 Left 1072450230 10:95533872-95533894 CCTGGACAGATCACCCCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG No data
1072450230_1072450238 -4 Left 1072450230 10:95533872-95533894 CCTGGACAGATCACCCCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1072450238 10:95533891-95533913 GTGGCACCAGGAAATGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072450230 Original CRISPR CCACAGGGGGTGATCTGTCC AGG (reversed) Intronic
901827221 1:11870055-11870077 TCACAGGTGCTGTTCTGTCCTGG - Intergenic
902552606 1:17228538-17228560 CCACAAAGGGGGCTCTGTCCTGG + Intronic
903178321 1:21593357-21593379 CCACAGGGGGTGCTCAGCCAGGG - Intergenic
904370382 1:30044286-30044308 CCCCAAGGGGTGGTCTGTGCAGG - Intergenic
904964635 1:34361976-34361998 CCACTTGGGGTGCTCAGTCCTGG - Intergenic
904998447 1:34649632-34649654 CCCTTGGGGGTGATCTGGCCTGG - Intergenic
906612695 1:47214262-47214284 CCTCAGGGACTGAGCTGTCCTGG + Intergenic
911190451 1:94943432-94943454 CCAGAGAGGGTGACCTGCCCAGG + Intergenic
912099260 1:106185254-106185276 CCACAGGGGCAGAGCTGCCCAGG + Intergenic
917178115 1:172261842-172261864 CCACAGGTGGTCAACTGGCCTGG + Intronic
917205230 1:172564384-172564406 CCACAGGGGTGGAGCTGCCCAGG + Intronic
1063310277 10:4945616-4945638 CCACAGGGGTAGAGCTGCCCAGG + Intronic
1066150050 10:32606533-32606555 CCACAGGGGCAGAGCTGCCCAGG + Intronic
1067441276 10:46310346-46310368 CCAAAGGCAGTGCTCTGTCCTGG + Intronic
1067507983 10:46872744-46872766 CCTCATGGGATGTTCTGTCCAGG - Intergenic
1067654268 10:48179101-48179123 CCTCATGGGATGTTCTGTCCAGG + Intronic
1070080638 10:73182995-73183017 CAACAGGAGGGGATCTGTACAGG - Intronic
1070083090 10:73207657-73207679 CCACAGGGGTAGAGCTGCCCAGG + Intronic
1072450230 10:95533872-95533894 CCACAGGGGGTGATCTGTCCAGG - Intronic
1075662451 10:124207502-124207524 AAACATGGGGAGATCTGTCCTGG + Intergenic
1077408876 11:2394466-2394488 CCACAGGGGGCGGTGTGCCCGGG - Intronic
1080851289 11:36072494-36072516 CCACAGGAGCAGAACTGTCCAGG - Intronic
1080894960 11:36441484-36441506 CCACAGGGGCAGAGCTGCCCAGG - Intronic
1081628641 11:44671936-44671958 CCACAGGGGCAGAGCTGCCCAGG + Intergenic
1082981960 11:59132096-59132118 CCACAGGGGCAGAGCTGCCCAGG + Intergenic
1084211722 11:67627423-67627445 CCAGAGGGGGTGCTCAGTCTAGG - Intergenic
1084453258 11:69252358-69252380 CCACAGGAGGTGCCCTGTGCAGG - Intergenic
1085418448 11:76335456-76335478 CCACAGGGGTGGAGCTGCCCAGG + Intergenic
1086148726 11:83584708-83584730 CCACAGAATGTGTTCTGTCCTGG + Intronic
1086841758 11:91694222-91694244 CCAGAGAAGGTCATCTGTCCTGG + Intergenic
1087045865 11:93843375-93843397 ACACAGGGGTTGGTCTGTCTTGG + Intronic
1087111579 11:94475401-94475423 CCACGGGGGGTGTTCGGTCCAGG - Intronic
1088953797 11:114598265-114598287 CCACAGGGGCAGAGCTGCCCAGG - Intergenic
1091703756 12:2680219-2680241 CCACAGGGGATGCCCTCTCCGGG - Intronic
1093537345 12:20237786-20237808 CCACAGGGGCAGAGCTGTCCAGG + Intergenic
1096657285 12:53099408-53099430 CCACTGGGGTTGAGCTGGCCTGG + Intronic
1096761733 12:53847499-53847521 CCCCAGAGGCTAATCTGTCCAGG + Intergenic
1100887283 12:99085250-99085272 CCACATGGGGTTATCTGCACTGG + Intronic
1102180450 12:110908901-110908923 CCACAGGGTGTGGGGTGTCCTGG + Intergenic
1103414878 12:120737265-120737287 CCTCAGGGCCTGTTCTGTCCAGG - Intronic
1111539280 13:89650206-89650228 CCACAGGGGCAGAGCTGCCCAGG - Intergenic
1113682503 13:112254227-112254249 CCACAGAGGGAGATCGGCCCAGG + Intergenic
1114433042 14:22678817-22678839 CCAAAGAGGCTGAGCTGTCCAGG + Intergenic
1114689106 14:24563724-24563746 CCACAGTGGGGGAGCTGCCCAGG + Intergenic
1115139970 14:30159546-30159568 CCTCAGGGTGTGATTTGGCCTGG + Intronic
1117626111 14:57639856-57639878 AAACATGGGCTGATCTGTCCAGG + Intronic
1120819041 14:88894969-88894991 CCACAGGGGGTGATATGTGCAGG + Intergenic
1122516783 14:102314509-102314531 ACACAGCGGGTGGTCAGTCCAGG - Intergenic
1122661912 14:103301718-103301740 ACGCAGGAGGTGAGCTGTCCGGG + Intergenic
1122848510 14:104513794-104513816 CCACCAGGGGGGATTTGTCCTGG + Intronic
1131977411 15:97960647-97960669 CCGCCGGGGGTGGGCTGTCCCGG + Intergenic
1136649895 16:31660133-31660155 CCACAAGGGGTGTTATGCCCTGG - Intergenic
1136650733 16:31667937-31667959 CCACAAGGGGTGTTATGCCCTGG - Intergenic
1141352808 16:83314449-83314471 TCACAGAGGGTGCTCTGTCCTGG - Intronic
1142052204 16:87966002-87966024 CCACGTGTGGTCATCTGTCCAGG - Intronic
1145795185 17:27651324-27651346 CCTCTGTGGGGGATCTGTCCAGG + Intergenic
1147215611 17:38897391-38897413 CCACGGGGGCTGCACTGTCCTGG - Intronic
1148025577 17:44585327-44585349 TCTCAGGGGATGATCTTTCCTGG + Intergenic
1148131300 17:45264091-45264113 CCAAAAGGGGTGAGCTGGCCAGG + Exonic
1148199431 17:45740120-45740142 CCACAGGGACTGCTCTGGCCTGG + Intergenic
1150131438 17:62671397-62671419 CCAGAGGAAGTGTTCTGTCCTGG + Intronic
1152530149 17:80913893-80913915 CCACAGGTGGTCACCTGTCAGGG + Intronic
1152532359 17:80926204-80926226 CCACAGGGACTGAGCTGTCATGG - Intronic
1156207855 18:34905789-34905811 CCACAGGGGTGGAGCTGCCCAGG - Intergenic
1162607320 19:11719649-11719671 CCAGAGTAGGTGATCTTTCCAGG - Intergenic
1164210158 19:23091538-23091560 CCACAGGGGTGGAGCTGTTCCGG + Intronic
1165391781 19:35543201-35543223 CCACAGGAGGGGATGTGTGCAGG - Intronic
1166877313 19:45905266-45905288 CTCCAGCGGGTGATCTTTCCTGG - Intergenic
1167590068 19:50399539-50399561 CCAGAGGGGCTGACCTGGCCCGG - Intronic
1167590084 19:50399584-50399606 CCAGAGGGGCTGACCTGGCCCGG - Intronic
1167802253 19:51751813-51751835 CCACAGCTGGTGAACAGTCCAGG - Exonic
1168126849 19:54288825-54288847 CCATGGGTGGTGAGCTGTCCCGG + Intergenic
926334307 2:11851675-11851697 CCCCAGGGGCTCAACTGTCCAGG - Intergenic
927866036 2:26588318-26588340 CCAAAGGAGGGGAACTGTCCAGG - Intronic
929783170 2:44970966-44970988 CAACAGGGGGTGTTTTCTCCTGG - Intergenic
932363540 2:71130388-71130410 CCACAAAGGGTGACCCGTCCTGG - Exonic
933099228 2:78230506-78230528 CCACAGGTGCTGATATGGCCAGG - Intergenic
933157161 2:78989188-78989210 CCACAGGGAGAGATCTTTCAGGG - Intergenic
935756734 2:106282270-106282292 TCACAGGGGGTGGGGTGTCCAGG - Intergenic
937092192 2:119213778-119213800 CCACAGAGTGTGGTCTGGCCTGG + Intergenic
938397664 2:130963228-130963250 CCACAGGGTGTGTCCTGCCCGGG + Intronic
940905103 2:159162017-159162039 CCAGAGAGGGTGATAAGTCCAGG + Intronic
942986168 2:182144971-182144993 CAACAGGCAGTGATCAGTCCTGG - Intronic
946676594 2:222167169-222167191 CCACAGGTGGTGATGTTTCATGG - Intergenic
947781224 2:232765603-232765625 GCACAGGGGGAGATCAGTTCTGG + Intronic
948662134 2:239514183-239514205 CTACAGGGAGGGCTCTGTCCAGG + Intergenic
948852775 2:240716508-240716530 ACCCAGGCTGTGATCTGTCCTGG - Exonic
1169010365 20:2245165-2245187 CCTCGGGGGGTGTTCTGTGCAGG + Intergenic
1172830152 20:37826991-37827013 GCACAGGGAGGGATCTGCCCAGG - Intronic
1173740899 20:45401044-45401066 CCACAGGGGTGGAGCTGCCCAGG + Intronic
1174158105 20:48529604-48529626 CCACCAGGAGTGAGCTGTCCTGG + Intergenic
1175824757 20:61930887-61930909 CCACAGAGGGTGCTCTGGCTGGG - Intronic
1177017983 21:15815508-15815530 CCACAGGGGCGGAGCTGCCCAGG + Intronic
1179320614 21:40287688-40287710 CCACAGGGGAGGATTTCTCCAGG + Intronic
1180050719 21:45329840-45329862 CAACAGCGCGTGATCCGTCCAGG - Intergenic
1183711077 22:39503802-39503824 CCACAGGGGGTGATCTAGGAGGG - Intronic
950219981 3:11187118-11187140 CCAGAGGGGGTCCTCTGGCCTGG + Intronic
950716028 3:14848314-14848336 GCAGAGGGGGTCAGCTGTCCTGG - Intronic
951700835 3:25495119-25495141 CCACAGGGGGTGATTTCTGTTGG - Intronic
952231847 3:31439505-31439527 CCACATGGGTTCATCAGTCCTGG + Intergenic
953492182 3:43361761-43361783 CCACAGAGGGTCAGCTGGCCTGG + Intronic
958076307 3:88684391-88684413 GCTCAGGGGGAGATCAGTCCTGG + Intergenic
958083781 3:88780332-88780354 CCACAGGGGCAGAGCTTTCCAGG - Intergenic
961943521 3:130661665-130661687 GCACAGGGGGTGGTCTGGCTTGG - Exonic
962453859 3:135547217-135547239 CCACAGGGGGGGATCTTTCTAGG + Intergenic
966115757 3:176458623-176458645 CCACAGGGGTGGAGCTGCCCAGG + Intergenic
968516940 4:1019418-1019440 CCACAGGGGCTGGGCTGGCCAGG + Intronic
968755989 4:2417038-2417060 CCACCGTGGGTGAGCTGTCACGG - Intronic
968895284 4:3397328-3397350 CCACAGGGTGGGCTCTGGCCCGG - Intronic
977463612 4:97356686-97356708 CCACAGGAGTGGAGCTGTCCAGG - Intronic
978374441 4:108060166-108060188 ACACAGGGGATGATCTGTACAGG + Intronic
979099762 4:116599625-116599647 CCATAGGGGGTGTTGGGTCCGGG - Intergenic
984454346 4:179945568-179945590 CCACAGGGGTGGAGCTGCCCAGG + Intergenic
984730761 4:183066020-183066042 CTCCAGGGGAGGATCTGTCCTGG - Intergenic
992852929 5:80829017-80829039 CCACTTGGGGTTGTCTGTCCTGG + Intronic
993736084 5:91477873-91477895 CAAAAGGGGGTGATATGACCAGG + Intergenic
993842494 5:92897723-92897745 CCACATGGAGTTATCTGCCCTGG + Intergenic
993882788 5:93382383-93382405 GCACAGAGGGACATCTGTCCAGG - Intergenic
995393106 5:111660857-111660879 CCACAGGGGTAGAGCTGCCCAGG - Intergenic
998377839 5:141702743-141702765 GCACTGGGGGTCATCTGCCCAGG - Intergenic
999458688 5:151739547-151739569 CCACAGGGGGAGCTCTGGCCTGG - Intergenic
1000079101 5:157827981-157828003 ACACAGTGGTTGATGTGTCCAGG - Intronic
1002085787 5:176774640-176774662 ACACAGGAGGTTATCTGTCCCGG - Intergenic
1002321959 5:178381618-178381640 ACACAGAGGGTGATCTGGCCTGG + Intronic
1010981662 6:82376300-82376322 CCACAGGGGTGGAGCTGCCCGGG - Intergenic
1012700467 6:102451068-102451090 CCACAGGGGTAGAGCTGACCAGG - Intergenic
1012765636 6:103363504-103363526 CCACAGGGGCAGAGCTGTCCAGG + Intergenic
1016892408 6:149019814-149019836 CCCCAGGGTGTGATCTGCCCAGG + Intronic
1017405639 6:154115714-154115736 TCTGAGGGGGTGATCTGCCCTGG + Intronic
1018700122 6:166419811-166419833 CCTCAGTGGCTGATCTGTCAGGG - Intronic
1020542169 7:9471291-9471313 CCACAGGGGCAGAGCTGTCCAGG + Intergenic
1020704328 7:11524632-11524654 CCACAGGGTCTGAGCTTTCCAGG + Intronic
1023998857 7:45178044-45178066 CCCCAGGGGGTGCCCTGGCCTGG + Intronic
1024980321 7:55152726-55152748 CCACAGGAAGTCTTCTGTCCTGG - Intronic
1033359238 7:140626423-140626445 CCACCCGGTGTGATCTGTCCTGG + Intronic
1033784890 7:144718236-144718258 CCACAGGGGTGGAGCTGCCCAGG + Intronic
1034446026 7:151114786-151114808 CCGCAGGGGGACAGCTGTCCCGG + Intronic
1034496453 7:151426191-151426213 CCACAGGGGATGATGTGTAGAGG + Intergenic
1045064867 8:98435929-98435951 CCTGAGGGGGTGATCTCTACTGG + Intronic
1045390273 8:101708267-101708289 CCAGAGGGGCTGATCTCTGCCGG + Intronic
1049279020 8:141734778-141734800 CCACTGGGGAGGCTCTGTCCAGG - Intergenic
1049726452 8:144148509-144148531 CCACCGGGGGTCCTCTCTCCGGG + Intronic
1052179322 9:25505269-25505291 CCACAGGGGTGGAGCTGCCCAGG - Intergenic
1058155109 9:101506168-101506190 CCACAGGGGCCCATCAGTCCTGG - Intronic
1059195469 9:112366907-112366929 CCACAGGGGTGGAGCTGCCCAGG + Intergenic
1059475843 9:114547022-114547044 CAACAGGAGCTGATCTTTCCAGG - Intergenic
1060988574 9:127835511-127835533 CCACAGGCTGTGCTGTGTCCTGG - Intronic
1061610174 9:131740467-131740489 CCACAGGGGATGCTGGGTCCGGG - Intergenic
1062268294 9:135697371-135697393 CCGCAGGTGGTGACCTGCCCAGG - Intronic
1062269107 9:135700580-135700602 CCACACGGGGACGTCTGTCCGGG + Intergenic
1062290216 9:135790978-135791000 CCACAGGGTGAGAACGGTCCTGG - Intronic
1062725012 9:138067842-138067864 CCTCTGGGGGTTATCTGTGCAGG - Intronic
1186448417 X:9652175-9652197 CCACATTGCATGATCTGTCCAGG - Intronic
1188771831 X:34162747-34162769 CCACAGGGGCTGATATGACATGG + Intergenic
1189642761 X:43091061-43091083 CCTCAGGGTGTGAACTGTCTTGG + Intergenic
1191095123 X:56665554-56665576 CCACAGGGGTAGAGCTGCCCAGG + Intergenic
1194199849 X:90941312-90941334 CCACAGGGGTGGAGCTGCCCAGG - Intergenic
1199315199 X:146368694-146368716 CTATAATGGGTGATCTGTCCCGG - Intergenic
1200545840 Y:4517728-4517750 CCACAGGGGTGGAGCTGCCCAGG - Intergenic