ID: 1072450233

View in Genome Browser
Species Human (GRCh38)
Location 10:95533885-95533907
Sequence CCATTTCCTGGTGCCACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072450233_1072450242 22 Left 1072450233 10:95533885-95533907 CCCCCTGTGGCACCAGGAAATGG 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1072450242 10:95533930-95533952 AAGAAGATAAAAGAAGGAGCTGG No data
1072450233_1072450241 16 Left 1072450233 10:95533885-95533907 CCCCCTGTGGCACCAGGAAATGG 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1072450241 10:95533924-95533946 TATTAGAAGAAGATAAAAGAAGG No data
1072450233_1072450240 -10 Left 1072450233 10:95533885-95533907 CCCCCTGTGGCACCAGGAAATGG 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072450233 Original CRISPR CCATTTCCTGGTGCCACAGG GGG (reversed) Intronic
901231706 1:7645383-7645405 CCATTTCCTGGCAGCCCAGGAGG + Intronic
901259095 1:7858082-7858104 TCATTCCCTGGTGACTCAGGGGG + Intergenic
902399163 1:16148483-16148505 CCATGCCGTGGTGCCACCGGGGG - Exonic
902555839 1:17246102-17246124 TCAATTTCTGCTGCCACAGGCGG + Intergenic
902712488 1:18249881-18249903 TCATTTCCTGCTGCCAGGGGAGG + Intronic
903240129 1:21977171-21977193 CCTATGCCTGGTTCCACAGGAGG + Intronic
904316579 1:29669963-29669985 CCCTTCCCTGGTGCCCCTGGAGG + Intergenic
905509336 1:38506124-38506146 CCATCTCCTGGTGCCATCGCAGG + Intergenic
905707679 1:40074159-40074181 CCATTTCCTTTAGCCCCAGGCGG + Exonic
906278023 1:44532800-44532822 CCATTTGCAGGAGACACAGGTGG - Intronic
908587598 1:65588600-65588622 CCATTCCCTGGGGACAGAGGTGG - Intronic
909900581 1:81129654-81129676 TTATTTCCAGGTGCCTCAGGTGG - Intergenic
910656235 1:89621619-89621641 CAATTTCCAGGTTCCCCAGGTGG - Intergenic
912500694 1:110120160-110120182 CCATTTCCTGGTGCCCTCTGGGG + Intergenic
912562222 1:110559215-110559237 GCATTTCCTGGGGCCTCAGTGGG - Intergenic
913645911 1:120853534-120853556 CCATTTCTTCGTGCACCAGGGGG - Intergenic
914080728 1:144409349-144409371 CCATTTCTTCGTGCACCAGGGGG + Intergenic
914175640 1:145277883-145277905 CCATTTCTTCGTGCACCAGGGGG + Intergenic
914530361 1:148519352-148519374 CCATTTCTTCGTGCACCAGGGGG + Intergenic
914678974 1:149925928-149925950 CCATGTCCTGCAGCCCCAGGAGG + Exonic
915453124 1:156020685-156020707 CCCTTTCTTGGTCCCACGGGCGG + Intronic
915569034 1:156733990-156734012 TCCTTTCCTGCTTCCACAGGTGG + Exonic
918068999 1:181121311-181121333 GCATTTCCAGATGCCCCAGGTGG + Intergenic
922471311 1:225879133-225879155 CCATTGGGTGGTGCCACTGGGGG - Intronic
923085716 1:230702265-230702287 CCTTTCCCAGGTGCCACATGGGG + Intergenic
1063586871 10:7360062-7360084 TCGTTACCTGGTACCACAGGAGG + Intronic
1063894013 10:10660073-10660095 CCATTTCCTGCTTCTAGAGGAGG - Intergenic
1067712348 10:48659024-48659046 CCATGTGCAGGAGCCACAGGAGG - Intergenic
1071299288 10:84244597-84244619 CCATTTTCTGGTCCCAGATGGGG + Intergenic
1071446750 10:85755764-85755786 CCATTTCCTGGTGACCTAGATGG + Intronic
1072369674 10:94752478-94752500 CCATCTGCTTGTGCCACAGCTGG + Intronic
1072385474 10:94921620-94921642 CCATCTGCTTGTGCCACAGCTGG + Intergenic
1072450233 10:95533885-95533907 CCATTTCCTGGTGCCACAGGGGG - Intronic
1073409209 10:103325709-103325731 CCATTTCCTACTGCCACTGATGG - Intronic
1073642042 10:105262636-105262658 CAATTTCCTGTGGCCAGAGGTGG - Intronic
1075093108 10:119454368-119454390 CCATTGCCTAGAGCCACGGGTGG + Intronic
1075619931 10:123918949-123918971 CCCTTTCCTGGTGCTCCAGCTGG - Intronic
1076298871 10:129409403-129409425 CATTTTCCTTGTGCCACAAGAGG - Intergenic
1076946982 10:133658245-133658267 TCATTTTCTGGAACCACAGGAGG + Intergenic
1077414447 11:2418241-2418263 CCACCTCCTGGTGCCCAAGGTGG - Exonic
1078930036 11:15905694-15905716 CCAGCTCCTGGGGCCAGAGGAGG - Intergenic
1078936727 11:15957840-15957862 CCATCTGCTGGTGCCAAAGTGGG + Intergenic
1079091199 11:17481576-17481598 CCATTCCCTAGTGACACAGCTGG + Intergenic
1080548934 11:33351789-33351811 CCATTTTCTAGTTCCACTGGTGG - Exonic
1081581108 11:44352781-44352803 CTATTTCCTGGCTCCACATGGGG + Intergenic
1082816657 11:57514156-57514178 CCCTTCCCTGGGGCCACTGGGGG - Intronic
1083000576 11:59287444-59287466 GAATTTCCGGGTGCCACAGATGG + Intergenic
1084287636 11:68142300-68142322 CCATTTCCTGGTAGCAGATGAGG + Intergenic
1088561660 11:111121708-111121730 CCATTACCTGCTGCCATAGCAGG + Intergenic
1092968898 12:13672553-13672575 CCATTCCCTGGAGCCACACCTGG + Intronic
1093336452 12:17911544-17911566 CCATCTTCTTGTGCCACAGCTGG - Intergenic
1093919400 12:24843108-24843130 GGATTTCATGGTGCAACAGGAGG - Intronic
1094359630 12:29616379-29616401 ACATTTTCTGGGGCCAGAGGCGG + Intronic
1097662428 12:62445778-62445800 CCATTTCCTGAGGCAACAGAGGG - Intergenic
1101486700 12:105171201-105171223 TCATTTCCTTGTGCAAAAGGTGG + Intergenic
1102761634 12:115390966-115390988 CCACTTCCAGGATCCACAGGTGG - Intergenic
1103242251 12:119423405-119423427 CCATTTCCTGCTCCCACCGGGGG + Intronic
1103905243 12:124324296-124324318 CCACTCCCTGGTGACTCAGGCGG + Intergenic
1103921549 12:124402039-124402061 CCCCTTCCTGGCGCCTCAGGAGG + Intronic
1104061103 12:125269296-125269318 ATTTTTCCTGGTGCCGCAGGAGG - Intronic
1104070735 12:125343181-125343203 ACATATCCTGGAGCCTCAGGAGG - Intronic
1104559495 12:129831145-129831167 CCAGTTCCTGGCTCCAGAGGAGG - Intronic
1104616923 12:130278386-130278408 TCATTTCTTGGTGGCGCAGGTGG - Intergenic
1104848673 12:131860548-131860570 CTAGGTCCTGGGGCCACAGGAGG + Intergenic
1107795856 13:44051010-44051032 ACATTTCCAGGTGCAAAAGGAGG - Intergenic
1111613658 13:90638078-90638100 CCATTTTGTGATGCCACATGGGG - Intergenic
1112100896 13:96188077-96188099 CCATGACCTGGTGCTATAGGGGG - Intronic
1112558778 13:100493282-100493304 CCATTTCATTCTGACACAGGTGG + Intronic
1113423281 13:110186456-110186478 CCATATCCTGGAGGCCCAGGGGG + Exonic
1115349312 14:32376419-32376441 CATTTTCCTGGGGCCACAGGAGG - Intronic
1118225130 14:63891481-63891503 CCTTTTCCTGGTGCAGCAGAGGG + Intronic
1118571524 14:67199858-67199880 CCATGTCCTGCAGCCCCAGGAGG - Intronic
1118651579 14:67901492-67901514 CCATTTCCAAGTGACAGAGGAGG - Intronic
1122401595 14:101470496-101470518 CCACTTCCTCGTTACACAGGTGG - Intergenic
1124259748 15:28178163-28178185 CCATCTCCTGGGGGCAGAGGAGG - Intronic
1124406788 15:29399946-29399968 CCATTTCAGGGTGGCAGAGGTGG + Intronic
1124440246 15:29680452-29680474 CCAGTTCCTGGTGCCAAAAAAGG - Intergenic
1124477337 15:30045876-30045898 CCATTCCCTGCTGCCAGGGGTGG - Intergenic
1125599403 15:40907110-40907132 CCACTTCCTGTTCACACAGGGGG - Intergenic
1128869517 15:71142907-71142929 ACATATGATGGTGCCACAGGTGG + Intronic
1129483199 15:75843774-75843796 CCAGTTCCTGGTGCCGCAGCAGG + Exonic
1129653332 15:77506769-77506791 ACATTTCCTGTTTCCACAGATGG - Intergenic
1130299082 15:82666583-82666605 GTAATTCCTGGTGCCACAGGAGG + Intronic
1133756746 16:8767578-8767600 CCACTTACAGCTGCCACAGGAGG + Intronic
1133982611 16:10644627-10644649 CCATTTCCTGGTGCCCCCATAGG - Intronic
1134059596 16:11191172-11191194 CCAGCTCCAGGTGCCACAGCAGG + Intergenic
1138652415 16:58468255-58468277 CCATTTCCAGGCGCCTCAGCGGG + Intronic
1140953886 16:79844872-79844894 GCCTTTCCTGGGGTCACAGGAGG + Intergenic
1141810147 16:86370698-86370720 CCACGTCCTGGTGCCACACTCGG + Intergenic
1141895026 16:86953801-86953823 CCATGCCCTGTGGCCACAGGAGG - Intergenic
1144523860 17:15973187-15973209 TCCTTGCCTGGAGCCACAGGTGG + Intronic
1144821365 17:18076953-18076975 CCATTCCCTGCTGCCACCTGAGG + Intergenic
1145849514 17:28078513-28078535 GAATTTACTGGTGCCACAGATGG - Intronic
1148876043 17:50687771-50687793 CCCATTCCTGATGCCCCAGGTGG - Intronic
1151788857 17:76291015-76291037 CCAGTTCCTGCTGGCACAGATGG - Exonic
1153444468 18:5155874-5155896 CGATGTCCTGGTCCCCCAGGAGG - Intronic
1153533805 18:6078658-6078680 CCAGTTCCTGGTGCCACTAAAGG - Intronic
1153666353 18:7370412-7370434 CCATTTCTGGGTGGCACAGGTGG - Intergenic
1158584168 18:58715721-58715743 CCATTTCCTGATGCCTCAGCTGG - Intronic
1158809214 18:61011872-61011894 CCATTCCCTGGTACCACTGGGGG + Intergenic
1161119066 19:2515219-2515241 CCATTCCCAAGAGCCACAGGCGG + Intronic
1161499689 19:4607076-4607098 CCAGTCCCGGGGGCCACAGGAGG + Intergenic
1161654847 19:5507872-5507894 CCATTTCCCAGTGACAGAGGCGG + Intergenic
1161744773 19:6049337-6049359 CCAGTTCCTTGTTCCGCAGGTGG + Intronic
1163129954 19:15266090-15266112 CCACCTCCTGGAACCACAGGGGG + Intronic
1163150146 19:15406932-15406954 GCATTTCCTTGTGCCACATAAGG - Intronic
1164037414 19:21466936-21466958 CCATTTCCTGCTACCATAGAGGG - Intronic
1164838250 19:31372705-31372727 ACATTTCTTGGGGGCACAGGAGG + Intergenic
1165169300 19:33879973-33879995 CCACTTCCTGGCGCCACCCGAGG + Intergenic
1167563199 19:50238924-50238946 CGATTTCCTGGTGACACTGCTGG - Intronic
926018613 2:9475079-9475101 CCATTCCCTGCGGGCACAGGTGG + Intronic
926236074 2:11044993-11045015 CCAGTTCCTGGTGCCAAAAATGG - Intergenic
929346544 2:40890731-40890753 CCAGTTCCTAGGCCCACAGGTGG - Intergenic
930018333 2:46986015-46986037 CCATTTCCAGGTGTCACACTTGG - Intronic
930930607 2:56877141-56877163 CAATGTCCTGGTTCCACAGTAGG - Intergenic
932581267 2:72994084-72994106 CCACCTCCTTATGCCACAGGGGG + Intronic
933795362 2:85915170-85915192 CCCTTCCTTGTTGCCACAGGTGG - Intergenic
937576908 2:123434873-123434895 CCAGTTCCTGGTGCCAAAAAGGG - Intergenic
938688840 2:133767750-133767772 CCACTTCATGGTGGCATAGGAGG - Intergenic
938957996 2:136316375-136316397 ACATTTCCTGGTGTTACATGGGG + Intergenic
939120087 2:138105829-138105851 CAGTTTCTTGGTGCCACAGAAGG + Intergenic
939522959 2:143255668-143255690 CCATTTCCTTGTGTTACAAGTGG + Intronic
943567792 2:189536581-189536603 CCATTTCTTGTTCACACAGGGGG + Intergenic
946239433 2:218344858-218344880 CCACTGCCTGGCGCTACAGGAGG + Exonic
947014040 2:225598050-225598072 CCATTCTCTGTTCCCACAGGAGG + Intronic
1170100214 20:12690851-12690873 CCATTCCATGTTTCCACAGGTGG + Intergenic
1174425732 20:50430578-50430600 CCCTCACCTGGTGCCCCAGGAGG + Intergenic
1175910162 20:62401457-62401479 CCATTGCTTGGTGCCTCTGGAGG + Intronic
1176146692 20:63568632-63568654 CCACTGCCTGGTGCCAGAGGCGG + Exonic
1176232501 20:64039403-64039425 CTATTTCCTGCTGCCTCCGGAGG + Intronic
1177180437 21:17739098-17739120 CCCTTTCCTAGTGCCACTGCTGG + Intergenic
1184176770 22:42793434-42793456 TTATTGCCTGGTACCACAGGTGG - Intergenic
1184869325 22:47225348-47225370 GCATTTCCTGGTGCCAGCTGGGG - Intergenic
1185214655 22:49591516-49591538 CCATTTCCTGGGGACACAGTGGG + Intronic
949333773 3:2951201-2951223 CCAGTTCCTGGTGCCAAAAAGGG - Intronic
951711340 3:25586949-25586971 GCAATTCCTGGTGCCTCATGGGG - Intronic
951944222 3:28115730-28115752 CCAGTTCCTGGTGCCAAAAACGG + Intergenic
955025764 3:55165945-55165967 CCATTTCCTGCTGGGACATGGGG - Intergenic
955041549 3:55322373-55322395 TCATTTCCTGGTTCCACAGAAGG - Intergenic
955215172 3:56979403-56979425 CTCGTTCCTGCTGCCACAGGAGG + Intronic
956250738 3:67231355-67231377 CCATTTCCATGTCCCACAGACGG + Intergenic
960543132 3:118882536-118882558 ACATTTGTTGGTGCCACAAGGGG + Intergenic
961773701 3:129268748-129268770 CTATTTTCTGGAGCCAGAGGTGG - Intronic
962403017 3:135077694-135077716 GCACATCCTGGTGCTACAGGAGG + Intronic
965367864 3:167821397-167821419 ACATTTCCTGGTGCCAGCAGTGG + Intronic
967913394 3:194560152-194560174 TCTCTTCCTGGAGCCACAGGTGG + Intergenic
967925221 3:194640489-194640511 GCATTTCCTGTTGGCAGAGGTGG + Intergenic
969193925 4:5545806-5545828 CCATTTTCTAGTCCAACAGGAGG + Intronic
970268210 4:14313056-14313078 CCATTTACTGGTGCTACATGAGG + Intergenic
971383347 4:26120063-26120085 CCATTTACTGGTGTCTCATGTGG - Intergenic
971909829 4:32781265-32781287 CCAGTTCCTGGTGCCAAAAAAGG + Intergenic
974626236 4:64431526-64431548 CCATTTCCAGGTGACCCAGAGGG + Intergenic
975250466 4:72172910-72172932 CCCTTTCCTCAAGCCACAGGGGG + Intergenic
975371895 4:73599098-73599120 CCATGCCCTGGGGACACAGGAGG - Intronic
976122628 4:81799933-81799955 CCCTTGCCTGGTTCCTCAGGTGG - Intronic
976743612 4:88381859-88381881 CCTTTTCTTGGTGCCAGAGATGG + Intronic
977816148 4:101416276-101416298 GCATTTCCTGGTGCCAGCCGTGG - Intronic
980730856 4:136823312-136823334 ACATTTCCTGGTGCCAGTTGTGG - Intergenic
982205847 4:152996600-152996622 CCAATTTCTGTTCCCACAGGAGG - Intergenic
982901447 4:161009168-161009190 TGGTTTCCTGGTGCCACAGTAGG - Intergenic
984296054 4:177855978-177856000 CCATTTCCTGCAGCCACCTGTGG + Intronic
985012523 4:185598916-185598938 CCATCTCGTGGACCCACAGGAGG + Intronic
985200997 4:187485481-187485503 CCGTCTCCTGTTGGCACAGGTGG + Intergenic
985450440 4:190059044-190059066 TCATTTTCTGGAACCACAGGAGG + Intergenic
985712918 5:1440055-1440077 CCATTTCATGGTGCCAGAGCAGG + Intronic
985954520 5:3253543-3253565 CCATTCCATGGTGGCACAGTGGG + Intergenic
987998406 5:25315945-25315967 CTTTTTCCTGGTACCATAGGAGG + Intergenic
988870470 5:35384463-35384485 CATTTTCCTGGAGCCACTGGGGG - Intergenic
989162679 5:38406834-38406856 CCACTTCCTGCTACCAAAGGAGG + Exonic
989510505 5:42281587-42281609 CCACTTCCTGGGGCAAGAGGTGG + Intergenic
990145676 5:52757383-52757405 CCATCTTCTGGTGCTCCAGGAGG - Intergenic
990335870 5:54772427-54772449 ACAATACCTGGTGCCACAGCTGG + Intergenic
990745046 5:58950585-58950607 CCATTTCCCAGGCCCACAGGTGG - Intergenic
992769062 5:80030324-80030346 CAAGTTCCTGGGGCCACAGGTGG + Intronic
994670351 5:102755448-102755470 CCAATTCCTGGTGCCCCAGGAGG + Intronic
994987522 5:106956377-106956399 CCGTTTCTCGGTGCCACAAGGGG - Intergenic
999438945 5:151586350-151586372 CATTTTCCTGTTGCCTCAGGTGG + Intergenic
1003302652 6:4898279-4898301 CTATTCCCTGGGGCCACAGCAGG + Intronic
1006253330 6:32808785-32808807 CCCTTTCCTTCTGCCACATGAGG + Intergenic
1006255423 6:32828935-32828957 CCAGATCCTGGTGCTCCAGGAGG - Intronic
1006980655 6:38145174-38145196 CCATTCCCTGTGGCCACTGGGGG + Intronic
1009395314 6:63193250-63193272 CCATCTCCTGCTGCTGCAGGAGG + Intergenic
1009653949 6:66515105-66515127 TCCTTCCCTGGTGACACAGGAGG - Intergenic
1011948725 6:92937762-92937784 CATTATCCTGGTCCCACAGGTGG + Intergenic
1013294096 6:108743356-108743378 CCATTTCCTGAGGCCATGGGGGG + Intergenic
1013349280 6:109290853-109290875 CCATTTCCGGGAAGCACAGGCGG + Intergenic
1016241600 6:141938026-141938048 CCATTTCCACGTGCCAAATGGGG + Intergenic
1017650026 6:156572247-156572269 CCATATACTGGTCCCAGAGGTGG + Intergenic
1019814992 7:3193117-3193139 ATATTTCCTGGTGACACACGAGG + Intergenic
1022843703 7:34189796-34189818 GGACTTCCAGGTGCCACAGGGGG + Intergenic
1023747403 7:43333964-43333986 CCGTTTCCTGGTCCCAGTGGAGG - Intronic
1024601332 7:50984276-50984298 CCATCTCCTGGTGTAACTGGAGG + Intergenic
1026134135 7:67644462-67644484 CCATGTGCTGGTGACACTGGGGG - Intergenic
1027479771 7:78681170-78681192 ACATTTCCAGGTGCCTCATGAGG + Intronic
1028077680 7:86535252-86535274 CCCTTTCCTGGGGGCACATGAGG + Intergenic
1028315276 7:89393771-89393793 CCCTTTCCTGCTACCACAAGTGG + Intergenic
1029177418 7:98674840-98674862 CCAGTTCCTGGTGTCCCATGGGG + Intergenic
1029250641 7:99233709-99233731 CCATTGCCTGGAGGGACAGGGGG + Intergenic
1030084819 7:105807086-105807108 CCAAATCCTGGGGCAACAGGTGG - Intronic
1030102374 7:105957785-105957807 CCTTTTCCTGGCTTCACAGGTGG - Intronic
1030148272 7:106378202-106378224 CCAATTCCTGGTGCCAAGGTTGG + Intergenic
1030191720 7:106817204-106817226 CCAGATGCTGGTGCCACTGGGGG - Intergenic
1032433207 7:131879832-131879854 CTATTTCCTTCTGCCAGAGGGGG + Intergenic
1034557979 7:151862029-151862051 CTATTTCCTGGTGCCATTGGAGG - Intronic
1035274286 7:157738006-157738028 CCATCTCCTGGTGCCCCAAAGGG + Intronic
1038250200 8:25896628-25896650 CCCTTTCCTCCTTCCACAGGTGG - Intronic
1038866932 8:31449280-31449302 CCACTTCCTGGTGCCAAAAAGGG - Intergenic
1039415098 8:37386615-37386637 CCCTTTCATGGTGGCCCAGGAGG - Intergenic
1039434000 8:37547219-37547241 CTCTGTCCTGGTGCCAGAGGAGG - Intergenic
1039589695 8:38736018-38736040 TGATTTCCTGGAGCCACTGGAGG - Intronic
1040111124 8:43567607-43567629 CCACTTTGGGGTGCCACAGGAGG + Intergenic
1041231627 8:55758064-55758086 CCTTTTCCTGGGGTCGCAGGAGG + Intronic
1041643897 8:60231232-60231254 TTATTTCATGGTGTCACAGGTGG - Intronic
1044887411 8:96794091-96794113 CCACTACGTGGTGCCACAGTAGG + Intronic
1046395157 8:113631945-113631967 GCATTTCCTGGTGCCAGCTGTGG - Intergenic
1046626691 8:116583436-116583458 CCCTGTCCTGGAGCCACAAGTGG + Intergenic
1046687153 8:117240136-117240158 CCTCTTCCTGGTGCCACCTGTGG - Intergenic
1046822800 8:118652627-118652649 CCTTCTCCTGGTGCCTCAGCCGG - Intergenic
1047104578 8:121719355-121719377 CCATTTCCTGGTGACAGTCGGGG - Intergenic
1048485999 8:134848049-134848071 CCATATGCTGGTGCCAAAGGTGG + Intergenic
1056864574 9:90218306-90218328 CCATATCCTAATGTCACAGGGGG - Intergenic
1057481468 9:95448322-95448344 CCATTTCCTGGAGGGACAGCAGG + Intronic
1059901370 9:118930164-118930186 CATATTCCTGGTGTCACAGGTGG - Intergenic
1060872368 9:127053109-127053131 CCATTCCCTGGTGCCAAAATGGG - Intronic
1061990105 9:134154193-134154215 CCATGGCCTGGTGCCCCAGGAGG + Intronic
1062321248 9:135991411-135991433 CCATTTCCTGGTTCCTAAAGGGG - Intergenic
1062464358 9:136674634-136674656 CCATTTCCGGGTGGCACCCGTGG - Intronic
1186111463 X:6261437-6261459 CCATTTCTTGCTGCCAGACGAGG - Intergenic
1186681411 X:11877964-11877986 CCATTCCCTGGTGCTTCAGCAGG + Intergenic
1189586092 X:42463493-42463515 ACAATTCCAGGGGCCACAGGTGG - Intergenic
1193308001 X:79972399-79972421 CCATTTGATGGTGCCCCAGTAGG - Intergenic
1193569702 X:83127595-83127617 CCATTTTCTGGAGGCACATGAGG - Intergenic
1199927171 X:152479945-152479967 CCATCTCCTGCTGCTGCAGGAGG - Intergenic
1200911090 Y:8532075-8532097 CCATTTTCAGGTCCCACTGGAGG - Intergenic