ID: 1072450240

View in Genome Browser
Species Human (GRCh38)
Location 10:95533898-95533920
Sequence CAGGAAATGGCAAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072450230_1072450240 3 Left 1072450230 10:95533872-95533894 CCTGGACAGATCACCCCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG No data
1072450229_1072450240 19 Left 1072450229 10:95533856-95533878 CCTGGCTATCTCTTATCCTGGAC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG No data
1072450227_1072450240 24 Left 1072450227 10:95533851-95533873 CCTGGCCTGGCTATCTCTTATCC 0: 1
1: 0
2: 4
3: 21
4: 340
Right 1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG No data
1072450233_1072450240 -10 Left 1072450233 10:95533885-95533907 CCCCCTGTGGCACCAGGAAATGG 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072450240 Original CRISPR CAGGAAATGGCAAAGGAAGC TGG Intronic
No off target data available for this crispr