ID: 1072450768

View in Genome Browser
Species Human (GRCh38)
Location 10:95537873-95537895
Sequence TTCTGCAAGGCCAAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072450760_1072450768 20 Left 1072450760 10:95537830-95537852 CCAAAAGAGGCCGGTGTGGTGGC 0: 1
1: 0
2: 2
3: 26
4: 222
Right 1072450768 10:95537873-95537895 TTCTGCAAGGCCAAGGTGGACGG No data
1072450761_1072450768 10 Left 1072450761 10:95537840-95537862 CCGGTGTGGTGGCTCACACCTGT 0: 166
1: 853
2: 2577
3: 5254
4: 7631
Right 1072450768 10:95537873-95537895 TTCTGCAAGGCCAAGGTGGACGG No data
1072450762_1072450768 -8 Left 1072450762 10:95537858-95537880 CCTGTAATCCCAGCATTCTGCAA No data
Right 1072450768 10:95537873-95537895 TTCTGCAAGGCCAAGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072450768 Original CRISPR TTCTGCAAGGCCAAGGTGGA CGG Intronic
No off target data available for this crispr