ID: 1072460200

View in Genome Browser
Species Human (GRCh38)
Location 10:95611626-95611648
Sequence CCCTCAAGACAGTTGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072460187_1072460200 28 Left 1072460187 10:95611575-95611597 CCTACTTTCCTCCCTCCAGCATG 0: 1
1: 0
2: 1
3: 52
4: 517
Right 1072460200 10:95611626-95611648 CCCTCAAGACAGTTGGAACAGGG 0: 1
1: 0
2: 1
3: 5
4: 118
1072460192_1072460200 13 Left 1072460192 10:95611590-95611612 CCAGCATGATCTGACTGGCCACT 0: 1
1: 0
2: 3
3: 16
4: 119
Right 1072460200 10:95611626-95611648 CCCTCAAGACAGTTGGAACAGGG 0: 1
1: 0
2: 1
3: 5
4: 118
1072460191_1072460200 16 Left 1072460191 10:95611587-95611609 CCTCCAGCATGATCTGACTGGCC 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1072460200 10:95611626-95611648 CCCTCAAGACAGTTGGAACAGGG 0: 1
1: 0
2: 1
3: 5
4: 118
1072460188_1072460200 20 Left 1072460188 10:95611583-95611605 CCTCCCTCCAGCATGATCTGACT 0: 1
1: 0
2: 0
3: 12
4: 197
Right 1072460200 10:95611626-95611648 CCCTCAAGACAGTTGGAACAGGG 0: 1
1: 0
2: 1
3: 5
4: 118
1072460195_1072460200 -5 Left 1072460195 10:95611608-95611630 CCACTTGCCAGCAATGGGCCCTC 0: 1
1: 0
2: 2
3: 17
4: 206
Right 1072460200 10:95611626-95611648 CCCTCAAGACAGTTGGAACAGGG 0: 1
1: 0
2: 1
3: 5
4: 118
1072460190_1072460200 17 Left 1072460190 10:95611586-95611608 CCCTCCAGCATGATCTGACTGGC 0: 1
1: 0
2: 2
3: 9
4: 108
Right 1072460200 10:95611626-95611648 CCCTCAAGACAGTTGGAACAGGG 0: 1
1: 0
2: 1
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072460200 Original CRISPR CCCTCAAGACAGTTGGAACA GGG Intronic
905947571 1:41916883-41916905 CCCTGGAGACAGTTGGACCCAGG - Intronic
912615713 1:111097620-111097642 CATTCAAGACAGTGGGAAAAAGG - Intergenic
914863427 1:151405576-151405598 CCCTGCAGACAGTGGGCACAGGG - Exonic
917855129 1:179093388-179093410 CCCTTAACAGAGGTGGAACACGG - Intronic
917917214 1:179714456-179714478 CACTCAAGACATTTAGAAAAAGG - Intergenic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
921485264 1:215708066-215708088 CCCAGAAGACAGTGGGAAGAAGG + Intronic
921926586 1:220714984-220715006 GCTTCCAGATAGTTGGAACATGG - Intergenic
923018195 1:230143011-230143033 CCCTAAAAACAGTTTGAACCAGG - Intronic
1065299834 10:24311326-24311348 CCCTCAAGACACTTCAACCACGG - Intronic
1065896242 10:30165323-30165345 TCCTCAGGACAGTGGGAAAATGG + Intergenic
1071969499 10:90888684-90888706 CACTCAAGACAGTTGACACCAGG + Intronic
1072460200 10:95611626-95611648 CCCTCAAGACAGTTGGAACAGGG + Intronic
1072606179 10:96984678-96984700 CCCTCCAGATAGTAAGAACAAGG + Exonic
1073490538 10:103850340-103850362 CCTTCAAGGCTGTTGGAACAGGG - Intronic
1073633044 10:105167867-105167889 GCCTCAAGAGAGTGGGTACAAGG + Intronic
1077301709 11:1850269-1850291 TCCACAAGACAGTTGCACCAAGG - Intergenic
1077479416 11:2806647-2806669 CCCCCAGGACAGGTGGAAGATGG - Intronic
1081693469 11:45094000-45094022 TCCTCAAGACAGCTGGAACAAGG - Intergenic
1087088354 11:94242663-94242685 CCCACAGGACAGAGGGAACATGG - Intergenic
1094259363 12:28475632-28475654 CACTCAAGACAGAGGGAAAATGG - Intronic
1094297379 12:28922936-28922958 CCCTGAAGACAGTAGAAACTTGG - Intergenic
1103906573 12:124330765-124330787 CCTTCATGACAGCTGGAGCAGGG + Intronic
1105949075 13:25213502-25213524 TATTCAAGACTGTTGGAACAGGG - Intergenic
1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG + Intergenic
1121211126 14:92208505-92208527 CACTGAAGACAGTAGGAACTAGG - Intergenic
1123463733 15:20497958-20497980 CACGCAAGAGAGTTGGAATATGG - Intergenic
1125685802 15:41562599-41562621 CTCACAAGACAGTTGGAAAGGGG - Exonic
1126376598 15:48002851-48002873 CCCTGAGGACAGTGGGAAAATGG - Intergenic
1127474211 15:59317328-59317350 CCCTAAAGAAACCTGGAACAAGG + Intronic
1131911004 15:97201165-97201187 CCCTCCAGACAGCTGGTACGTGG + Intergenic
1136714728 16:32269262-32269284 CCCTCACCACACTTGGAACCTGG + Intergenic
1136753181 16:32660485-32660507 CCCTCACCACACTTGGAACCTGG - Intergenic
1136814932 16:33209880-33209902 CCCTCACCACACTTGGAACCTGG + Intronic
1136821408 16:33319960-33319982 CCCTCACCACACTTGGAACCTGG + Intergenic
1136827971 16:33376499-33376521 CCCTCACCACACTTGGAACCTGG + Intergenic
1136833037 16:33475270-33475292 CCCTCACCACACTTGGAACCTGG + Intergenic
1202993509 16_KI270728v1_random:32854-32876 CCCTCACCACACTTGGAACCTGG + Intergenic
1203055323 16_KI270728v1_random:920507-920529 CCCTCACCACACTTGGAACCTGG - Intergenic
1144087234 17:11821791-11821813 CCAGCAAGAGAGTTGGTACATGG + Intronic
1153966875 18:10190260-10190282 CCATCAAGACTGTGGGACCAGGG + Intergenic
1154070981 18:11150691-11150713 GACTCAAGACAGTTGGCATATGG + Intergenic
1154142651 18:11838539-11838561 CTCACAAGCCAGTTGCAACAGGG - Intronic
1162311782 19:9912491-9912513 CCCCCCAAACAGATGGAACAGGG + Intronic
1163739148 19:18999999-19000021 AACTTAAGACAGTTGGACCAGGG - Intronic
1164671476 19:30074493-30074515 TCCTCAGCACAGTGGGAACAAGG + Intergenic
1165702940 19:37952281-37952303 CCCTCAAGTCAGTTTGAATTGGG + Intronic
925130299 2:1489520-1489542 CCCACAGGCCAGTGGGAACATGG - Intronic
926468848 2:13227661-13227683 CCCTCAAGGAACTTGCAACAGGG + Intergenic
927943168 2:27118548-27118570 CCCCCAGGACTGCTGGAACACGG + Intronic
928586453 2:32763280-32763302 CCCTCCAGACAGTTCAAACTTGG - Intronic
929814404 2:45219783-45219805 CCATCAACTCACTTGGAACAGGG - Intergenic
931220402 2:60283932-60283954 CCCTGAAGACTGTAGGGACAAGG + Intergenic
936955282 2:118016365-118016387 TCGTCAAGAAAGTTTGAACAGGG + Intergenic
936970070 2:118168694-118168716 CCATGAAGAGAGTTGGAACTAGG - Intergenic
938646487 2:133336168-133336190 CACTCAAGACAGTTGGTAAATGG - Intronic
939076786 2:137612385-137612407 CCCTCCAGAGAGCTGGAATAGGG - Intronic
940114113 2:150189143-150189165 CACTCAAGTCTGTTGAAACATGG + Intergenic
940649168 2:156424012-156424034 CCCTTAATATAGTTGGAACCTGG + Intergenic
943779950 2:191812526-191812548 CCCTGAAGGCAGCTGAAACATGG - Intergenic
945681659 2:212921151-212921173 CCCTCAATACGGTTGGAGCGTGG - Intergenic
948014131 2:234673933-234673955 CCCACTACACAGTTGGCACATGG + Intergenic
948574475 2:238940908-238940930 CCCTCAAAACAGTTAGAGCCTGG - Intergenic
948894411 2:240921645-240921667 CCCCCAAGACAGGCGGAACGGGG + Intronic
1169247570 20:4035572-4035594 CCCACAAAACAGTTGGCCCATGG + Intergenic
1169500815 20:6158700-6158722 CCCTCCAGAAAGATGGACCAAGG + Intergenic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1172677133 20:36680951-36680973 TCTTCTAAACAGTTGGAACATGG + Intronic
1173881660 20:46418223-46418245 ATCTGAACACAGTTGGAACACGG - Intronic
1175736970 20:61393829-61393851 CCACCAAGACAGTTGCACCATGG + Intronic
1177625659 21:23656314-23656336 TCCTCAAGACAGTTGTGAGATGG + Intergenic
1180614221 22:17117459-17117481 CCCCCAAAACAGTTGTAAGAGGG + Exonic
1185145663 22:49134377-49134399 CCCTAAACACACTTGGCACAGGG + Intergenic
951067349 3:18282541-18282563 CCCTCCAGAGAGCTGGAACCAGG + Intronic
952414284 3:33076301-33076323 GCCTCAATATAGTTGAAACATGG + Intronic
953359417 3:42281733-42281755 CCATCAAGGCTGGTGGAACAGGG - Intergenic
956507619 3:69959462-69959484 ACTTCAAGACAGTAGAAACAGGG + Intronic
958094103 3:88919273-88919295 CCCTTGAGCCAGTTGAAACAAGG - Intergenic
959924347 3:111904765-111904787 ACCACAGGACAGTGGGAACAAGG + Intronic
964192429 3:154018786-154018808 CCATGAAAACAGTTGGAAGAGGG + Intergenic
967176694 3:186867075-186867097 CCCACAAAACAGTTGGCCCATGG + Intergenic
967327981 3:188261094-188261116 CACTAAAGACAATTTGAACAAGG + Intronic
967966570 3:194964961-194964983 CTCCCAGGAGAGTTGGAACAGGG + Intergenic
968604785 4:1529723-1529745 CCCTGATGACAGTCGGCACATGG + Intergenic
969452991 4:7285625-7285647 CCCTCCAGACAGCTGGCAGAGGG + Intronic
969951791 4:10844332-10844354 CTCTCAAGACAAATGGAAAAGGG + Intergenic
972021288 4:34317372-34317394 CCCATAAGACAGTTTGGACATGG - Intergenic
977231867 4:94461087-94461109 TCCTCAATACAGTTGTAACTGGG - Intronic
977381761 4:96283386-96283408 CCCTCAAGACATTCAGAACCTGG + Intergenic
983224146 4:165070545-165070567 CCATCAATACAGTTGGATAAAGG - Intergenic
984480067 4:180288962-180288984 CACTCAAGACACTTGGACAAAGG - Intergenic
987290690 5:16505635-16505657 CCTTCAGGACAGCTGGAACAGGG + Intronic
987677871 5:21098451-21098473 TCCTCAAGACATTTGGACTAAGG - Intergenic
990037678 5:51342047-51342069 CTCTCAATCCTGTTGGAACATGG + Intergenic
991489460 5:67167816-67167838 CCTTTTAGACAGTTGGACCAGGG - Exonic
992452255 5:76885410-76885432 CCCCCAGGAAAGTGGGAACAGGG + Intronic
996499357 5:124199533-124199555 CTCTCAAGACAGGTTGCACAGGG - Intergenic
997600279 5:135134216-135134238 CCCGCCAGACAGTTGGGGCAGGG + Intronic
1006608139 6:35274329-35274351 AACTCTGGACAGTTGGAACAAGG - Intronic
1007066233 6:38992734-38992756 CTCTCAAGAAAGATGAAACAGGG + Intronic
1009030422 6:58050571-58050593 CTATCAAGACATTTGAAACAAGG - Intergenic
1015426146 6:133070119-133070141 CTCTCAACACAGTTGAACCAGGG + Intergenic
1021413588 7:20355976-20355998 CCCTCAAAACAGGGGGAGCAAGG - Intronic
1022405476 7:30085953-30085975 GCCTCCAGACAGCTGGAACTAGG - Intronic
1023081387 7:36529890-36529912 CCTTCCAGAAAGTTGGGACATGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024790821 7:52963301-52963323 ACCTCATGGCAGTTAGAACAGGG + Intergenic
1025211626 7:57022403-57022425 CCATCAAGCCACTTGGAACCTGG - Intergenic
1025660330 7:63554424-63554446 CCATCAAGCCACTTGGAACCTGG + Intergenic
1025853785 7:65261730-65261752 CCCACAAAACAGTTGGCCCATGG + Intergenic
1026643756 7:72150230-72150252 CCCTCAAGCAAATTGGAACTTGG - Intronic
1029671772 7:102037752-102037774 CCCTAAAGAAAGTGGAAACATGG + Intronic
1031648815 7:124260297-124260319 CCCTCTAGACAGTTGGAAACAGG + Intergenic
1039720000 8:40153144-40153166 CCCAAACGACAGTTAGAACAAGG - Intergenic
1046752057 8:117936571-117936593 CCCTCAACACAGTTTAAACAAGG - Intronic
1048180388 8:132189138-132189160 CCATCAAGACAGAAGGCACATGG - Intronic
1050504200 9:6330224-6330246 AGCTCAAGACAGTAGGAACCTGG + Exonic
1053425839 9:38009317-38009339 CCCTCAGGACTGTTAGAACCAGG + Intronic
1057027354 9:91744919-91744941 CCCTGAAGTCAGTTGGTAAAAGG + Intronic
1058487213 9:105453547-105453569 CCCTCAAAAGAGTTGAAAAAAGG - Intronic
1187071694 X:15894615-15894637 AACTGAAGACAGTGGGAACAGGG + Intergenic
1187923787 X:24231795-24231817 AAATCAAGCCAGTTGGAACAGGG - Intergenic
1189167185 X:38871736-38871758 CCCTTAAGACAGTTGGAGTTGGG - Intergenic
1192202786 X:69077640-69077662 CCCTCAAGACCTTTGGAAAGGGG + Intergenic
1193551588 X:82899738-82899760 TCATCAAGACAGTGGCAACAGGG - Intergenic