ID: 1072460722

View in Genome Browser
Species Human (GRCh38)
Location 10:95616367-95616389
Sequence GTCTGCTTGTAGTAGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072460721_1072460722 -7 Left 1072460721 10:95616351-95616373 CCTGCTGGAGTGTCAAGTCTGCT 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1072460722 10:95616367-95616389 GTCTGCTTGTAGTAGTGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 114
1072460718_1072460722 16 Left 1072460718 10:95616328-95616350 CCTAAAGTCTGAAGGCTCACAGG 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1072460722 10:95616367-95616389 GTCTGCTTGTAGTAGTGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072460722 Original CRISPR GTCTGCTTGTAGTAGTGTCT TGG Intronic
904093143 1:27959078-27959100 GTATGCTTGTAGGGGGGTCTTGG - Exonic
905921738 1:41724118-41724140 GGTAGCTTGAAGTAGTGTCTTGG + Intronic
906976488 1:50579081-50579103 GTTTGCTTTTCTTAGTGTCTAGG - Intronic
909386214 1:75059674-75059696 GTTTTCTTGTAGTAGTTTCACGG - Intergenic
910635995 1:89408451-89408473 GTCTTCTTTTAGTAGAGACTGGG + Intergenic
916768815 1:167887898-167887920 GTTTTCTTGTAGTAGTTTCATGG + Intronic
920627278 1:207614422-207614444 GTCTGCTAGTCATTGTGTCTTGG + Exonic
920637222 1:207715330-207715352 GTCTGCTAGTCATTGTGTCTTGG + Intronic
921277483 1:213534105-213534127 GGCTGCCTGGAGTATTGTCTTGG + Intergenic
923820779 1:237438254-237438276 GTCTGCTAGTTGTAGGATCTGGG + Intronic
1063511550 10:6649301-6649323 GTCAGCCTGGAGTAGGGTCTGGG + Intergenic
1063875946 10:10478752-10478774 GTCTGCTTCCAAAAGTGTCTGGG - Intergenic
1065299275 10:24306396-24306418 GGTTTCTTATAGTAGTGTCTAGG - Intronic
1066584326 10:36915138-36915160 GTTTCCTTTTAGTAGTTTCTTGG + Intergenic
1072460722 10:95616367-95616389 GTCTGCTTGTAGTAGTGTCTTGG + Intronic
1074436926 10:113442134-113442156 GACTGCTCCAAGTAGTGTCTGGG + Intergenic
1075705289 10:124496956-124496978 GTCTCCTTGTAGTAACGCCTAGG - Exonic
1076138491 10:128061440-128061462 GTCTGCTTGTGGGTGAGTCTGGG + Intronic
1077547667 11:3182570-3182592 GTCTGCATGCACTTGTGTCTGGG - Intergenic
1077548274 11:3186432-3186454 GTCTGCATGCACTTGTGTCTGGG - Intergenic
1087367118 11:97234076-97234098 TTCTGCTTTTAGTAGTTTTTTGG + Intergenic
1088662395 11:112060636-112060658 GTATGTTTTTAGTAGTGTCGGGG + Intronic
1098205123 12:68100970-68100992 GTCTGCTGGAAGCAGTGTCTTGG - Intergenic
1099687866 12:85912152-85912174 GTTTTCTTGTAGTAGTTTCATGG + Intergenic
1104680374 12:130746985-130747007 CTCTGCTTGTTGTAGTTCCTAGG - Intergenic
1105567135 13:21560749-21560771 TTATGCTTGTAGAAATGTCTAGG + Intronic
1106290262 13:28354726-28354748 GTCTGCTTTTTGTAGTTTTTTGG - Intronic
1106950675 13:34880331-34880353 GTCTGGTTGTAGGACTGACTTGG - Intergenic
1109701393 13:66029471-66029493 GCCTGCTTGATGTAGTGTTTAGG + Intergenic
1111364832 13:87228869-87228891 GTCTTCTTATAGTAGTTTCATGG + Intergenic
1112418878 13:99229180-99229202 GGCTGCTCATAGTAGTGTGTGGG + Intronic
1112652433 13:101414924-101414946 GTCTGGTTTTAGCAGTGGCTAGG + Intronic
1112944222 13:104906501-104906523 GTTTCCTTGTAGTAGTTTCATGG + Intergenic
1117789874 14:59329169-59329191 GACTTCTTGGAATAGTGTCTGGG + Intronic
1119717085 14:76867036-76867058 GTGTGCATGTGGTAGTGTGTGGG + Intronic
1126534405 15:49745622-49745644 GTTTTCTTGTAGTAGTTTCATGG - Intergenic
1126944175 15:53800194-53800216 GTTTCCTTGTTGTAATGTCTTGG - Intergenic
1127035598 15:54913676-54913698 GTTTTGTTGTAGTAGTGTCATGG - Intergenic
1132194645 15:99903848-99903870 GCCTGCTTTTAGTGCTGTCTGGG + Intergenic
1132558305 16:582369-582391 GTCAGCTGGGTGTAGTGTCTGGG + Intronic
1133716649 16:8456588-8456610 GTTTTCTTGTAGTAGTTTCATGG - Intergenic
1134430164 16:14196667-14196689 GTTTGCTCTTTGTAGTGTCTGGG + Intronic
1139554103 16:67695431-67695453 GTCTGCTTTTACAGGTGTCTTGG + Intronic
1140232040 16:73125251-73125273 GTCTGCTTTGAGTTGTGGCTTGG + Intergenic
1141875587 16:86822120-86822142 GTCTGCCTGCAGTAGTGAATGGG - Intergenic
1142330964 16:89453468-89453490 TTTGGCTTGTAATAGTGTCTGGG - Intronic
1152618545 17:81349277-81349299 GTCTGCTTGCTGTGGTCTCTAGG + Intergenic
1159730967 18:72027158-72027180 GTTTTCTTGTAGTAGTTTCATGG + Intergenic
1166326717 19:42055359-42055381 CTCTGCGCGTAGAAGTGTCTTGG + Intronic
1168492900 19:56825135-56825157 GTCTGATTTTAGTACTGGCTAGG - Intronic
928695772 2:33848436-33848458 CTCTGCTTTCAGTAGTTTCTTGG - Intergenic
929318020 2:40504344-40504366 GTTTTCTTGTAGTAGTTTCATGG - Intronic
929804945 2:45136716-45136738 GTCTGCCTGGAGATGTGTCTTGG + Intergenic
931927617 2:67091355-67091377 GTTTTCTTGTAGTAGTTTCATGG - Intergenic
935112766 2:100107130-100107152 GTTTTCATGTAATAGTGTCTTGG + Intronic
937085052 2:119166034-119166056 GTGAGCTTGTTGCAGTGTCTGGG + Intergenic
942094130 2:172521921-172521943 GTCGGCCTGCAGTAGTATCTTGG - Intergenic
942115275 2:172722572-172722594 GGCTGCTTGTAGTGCTGTGTTGG + Intergenic
944990190 2:205226461-205226483 GTTTTCTTGTAGTAGTTTCATGG + Intronic
1169278889 20:4250608-4250630 GCCTGTTTGCAGAAGTGTCTGGG + Intergenic
1171813644 20:29764163-29764185 GTTTGCTCGTAGTAGTGTTGGGG - Intergenic
1172154094 20:32811368-32811390 GTTTGCTTGGATTTGTGTCTGGG + Intergenic
1178116655 21:29424770-29424792 GTCTGCTTCAAGTACTGGCTGGG + Intronic
1178413820 21:32387744-32387766 GTCTGCTTTAGGGAGTGTCTGGG + Intronic
1179648822 21:42793372-42793394 TTCTGCTTGTAAGAGTGTCCAGG - Intergenic
950408452 3:12819029-12819051 GTCTGCTTCTAGTAGGTTCCTGG + Intronic
951904777 3:27694118-27694140 GTTTTCTTGTAGTAGTTTCATGG - Intergenic
952532222 3:34274496-34274518 GACTGCTTGGAGTACTGTGTTGG + Intergenic
952953670 3:38543646-38543668 CTCTGCCTGTAGGAGTGCCTGGG + Intergenic
956945619 3:74218949-74218971 GTGTGCTGGTAGGAGTGTGTAGG + Intergenic
958593823 3:96195587-96195609 GTATGTTTGTAGTGTTGTCTTGG + Intergenic
958768809 3:98402238-98402260 GTCTGCTTGCAGGACAGTCTTGG + Intergenic
960638263 3:119804907-119804929 GTGTGCTTGTTGAAATGTCTAGG - Intronic
965236500 3:166131039-166131061 GTTTTCTTGTAGTAGTTTCATGG + Intergenic
965395219 3:168154152-168154174 TGCTGGTTGTAGTAGTGTATTGG + Intergenic
965453840 3:168872997-168873019 GTGTACTTGTAGTAATTTCTGGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
970384808 4:15545622-15545644 TTCTGCTTGTAGAACTGCCTTGG - Intronic
976116154 4:81729539-81729561 GTTTTCTTGTAGTAGTTTCATGG - Intronic
980098046 4:128513171-128513193 GTCTGCTGTTTTTAGTGTCTGGG + Intergenic
981578053 4:146225560-146225582 CTCTGCTTTTAGGAGTGTCTTGG - Intronic
983629047 4:169830899-169830921 GTGTGTTTGTAGTAGTCTCTGGG - Intergenic
990723202 5:58722278-58722300 GTCACCTTTTAGCAGTGTCTTGG + Intronic
993531640 5:89032522-89032544 ATCTGCTTCTAGTTTTGTCTGGG + Intergenic
993757875 5:91753382-91753404 GTTTTCTTGTAGTAGTTTCATGG + Intergenic
996324997 5:122262774-122262796 ATCTGCTTGAAGTAGTCTTTTGG + Intergenic
996945370 5:129060650-129060672 GTCTTCTTTTAGTAGTTTCATGG - Intergenic
997039829 5:130239668-130239690 ATCTACTTGTAGTATTTTCTTGG + Intergenic
997665578 5:135627301-135627323 GTCTGTTTGGGGCAGTGTCTAGG + Intergenic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1001408487 5:171493952-171493974 GTCTGCTTGTGGGTGTATCTGGG - Intergenic
1006242305 6:32694680-32694702 GTTTTCTTGTAGTAGTTTCATGG - Intergenic
1006638555 6:35476796-35476818 GTGTGCTTGTAGCTGTGTATTGG + Intronic
1014941059 6:127439221-127439243 GTTTGCTTGAAGTATTATCTTGG - Exonic
1016185185 6:141190059-141190081 GTTTCCTTGTAGTAGTTTCATGG + Intergenic
1018655741 6:166034049-166034071 CTCAGCTTCTAGTGGTGTCTGGG - Intergenic
1018695311 6:166386373-166386395 GTCTGCTTGTAGAAGGGGCTGGG + Intergenic
1019583910 7:1785691-1785713 GTCTGTTTGTTGTAGTGTATGGG + Intergenic
1029737221 7:102471669-102471691 GTCTGCTTGGAGAAGTGTCCCGG - Intronic
1030748164 7:113194335-113194357 GTGTTCTTGTAGTAGTTTCATGG + Intergenic
1030759534 7:113333182-113333204 GTCTGCCTGTATTATTGTGTGGG - Intergenic
1033760984 7:144436484-144436506 GTCTGCTTGAAGCATTGTGTGGG + Intergenic
1036998581 8:13689431-13689453 GTCTGCTTGTCAAAGAGTCTGGG + Intergenic
1042830086 8:73017350-73017372 GTCTGCTTGTACTACTTGCTTGG + Intronic
1045552598 8:103185974-103185996 CTCTGCTTGTTCTGGTGTCTTGG + Intronic
1048920641 8:139226929-139226951 GTACTCTTGTAGTAGTATCTTGG - Intergenic
1049638245 8:143700933-143700955 GTCTCCGTGCAGGAGTGTCTTGG - Intronic
1055042159 9:71885830-71885852 ATCTCCTTGTAATAGTTTCTTGG + Intronic
1058009580 9:99961629-99961651 TTCTGCTTGCAGTTCTGTCTAGG + Intronic
1059900142 9:118915455-118915477 GTTTTCTTGTAGTAGTTTCAAGG + Intergenic
1062082977 9:134634151-134634173 GTCTGCAGGGAGAAGTGTCTAGG + Intergenic
1186462047 X:9755553-9755575 GCCAGCTTTAAGTAGTGTCTTGG - Intronic
1187135741 X:16545629-16545651 GCCTGCTTGCAGCAGTGACTGGG - Intergenic
1189750562 X:44216755-44216777 GTTTTCTTGTAGTAGTTTCATGG - Intronic
1190588712 X:51975200-51975222 GTCTGCTGTTAGCAGTGTTTTGG + Intergenic
1193192464 X:78587678-78587700 GTTTTCTTGTAGTAGTTTCATGG + Intergenic
1193957503 X:87880165-87880187 GTTTTCTTGTAGTAGTTTCATGG + Intergenic
1195074914 X:101317468-101317490 GTTTTCTTGTAGTAGTTTCATGG + Intergenic
1196481247 X:116152283-116152305 GTTTTCTTGTAGTAGTTTCATGG - Intergenic
1196578721 X:117353709-117353731 GTTTTCTTGTAGTAGTTTCAAGG + Intergenic
1198612725 X:138419643-138419665 GTTTTCTTGTAGTAGTTTCATGG - Intergenic