ID: 1072465276

View in Genome Browser
Species Human (GRCh38)
Location 10:95656899-95656921
Sequence CAGGGGGAACGCCCACGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 75}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072465271_1072465276 1 Left 1072465271 10:95656875-95656897 CCTGGAAGAGGCGGGACTCGAGT 0: 1
1: 0
2: 2
3: 6
4: 97
Right 1072465276 10:95656899-95656921 CAGGGGGAACGCCCACGTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 75
1072465260_1072465276 23 Left 1072465260 10:95656853-95656875 CCAGCCCACCAGGCCCCGGCAGC 0: 1
1: 0
2: 4
3: 74
4: 645
Right 1072465276 10:95656899-95656921 CAGGGGGAACGCCCACGTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 75
1072465263_1072465276 18 Left 1072465263 10:95656858-95656880 CCACCAGGCCCCGGCAGCCTGGA 0: 1
1: 1
2: 3
3: 48
4: 437
Right 1072465276 10:95656899-95656921 CAGGGGGAACGCCCACGTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 75
1072465261_1072465276 19 Left 1072465261 10:95656857-95656879 CCCACCAGGCCCCGGCAGCCTGG 0: 1
1: 0
2: 3
3: 30
4: 343
Right 1072465276 10:95656899-95656921 CAGGGGGAACGCCCACGTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 75
1072465268_1072465276 9 Left 1072465268 10:95656867-95656889 CCCGGCAGCCTGGAAGAGGCGGG 0: 1
1: 0
2: 1
3: 38
4: 367
Right 1072465276 10:95656899-95656921 CAGGGGGAACGCCCACGTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 75
1072465270_1072465276 8 Left 1072465270 10:95656868-95656890 CCGGCAGCCTGGAAGAGGCGGGA 0: 1
1: 0
2: 3
3: 30
4: 326
Right 1072465276 10:95656899-95656921 CAGGGGGAACGCCCACGTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 75
1072465266_1072465276 10 Left 1072465266 10:95656866-95656888 CCCCGGCAGCCTGGAAGAGGCGG 0: 1
1: 0
2: 3
3: 11
4: 208
Right 1072465276 10:95656899-95656921 CAGGGGGAACGCCCACGTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 75
1072465264_1072465276 15 Left 1072465264 10:95656861-95656883 CCAGGCCCCGGCAGCCTGGAAGA 0: 1
1: 0
2: 1
3: 29
4: 285
Right 1072465276 10:95656899-95656921 CAGGGGGAACGCCCACGTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072465276 Original CRISPR CAGGGGGAACGCCCACGTCC CGG Intergenic