ID: 1072467550

View in Genome Browser
Species Human (GRCh38)
Location 10:95680557-95680579
Sequence ACCTGGATCTCCAGGGAAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072467544_1072467550 -5 Left 1072467544 10:95680539-95680561 CCTACATATGCCCACAATACCTG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1072467550 10:95680557-95680579 ACCTGGATCTCCAGGGAAACTGG 0: 1
1: 0
2: 2
3: 32
4: 258
1072467541_1072467550 28 Left 1072467541 10:95680506-95680528 CCTGATACATGAGCTTGCGGGTT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1072467550 10:95680557-95680579 ACCTGGATCTCCAGGGAAACTGG 0: 1
1: 0
2: 2
3: 32
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072467550 Original CRISPR ACCTGGATCTCCAGGGAAAC TGG Exonic
900179619 1:1305504-1305526 TGCTGGCTCTCCAGGGACACGGG - Intronic
901243053 1:7705660-7705682 ACCTGTCTGCCCAGGGAAACCGG - Intronic
904531666 1:31173969-31173991 ACCTGGATCACCTGGGGCACTGG + Intergenic
908573474 1:65434712-65434734 ACCTGGATCTCAAGGGCATTAGG - Exonic
908675076 1:66594529-66594551 ACCTGGATCTCCAAGGCTAAGGG - Intronic
909211488 1:72830570-72830592 GCCTGGAACTCCAGTGAGACAGG + Intergenic
909565172 1:77045689-77045711 CCCTGGAGGTCCAGGGAATCAGG + Intronic
910277232 1:85462763-85462785 ATCTGGGTCACCAGGGTAACAGG - Intronic
910657896 1:89636709-89636731 ACAAGGATCTGGAGGGAAACAGG - Intronic
911284649 1:95974946-95974968 ACCTGGAACTCCAGTGACACAGG - Intergenic
912276271 1:108261970-108261992 ACCTGGAACTCCAGTGAGGCAGG + Intergenic
912291957 1:108432388-108432410 ACCTGGAACTCCAGTGAGGCAGG - Intronic
912945312 1:114079609-114079631 ACCTGGATGTGCAGGGCAGCGGG + Intergenic
915046109 1:153018404-153018426 ACCTGGAACTCCAGTGAGGCAGG + Intergenic
915491233 1:156251056-156251078 ACCAGGATCTCCAGGGGACAGGG + Intronic
916726183 1:167526160-167526182 TGCTGGAACTCCAGGGAAAGGGG + Intergenic
917232839 1:172856280-172856302 ACCTGGAACCCCAGTGAGACAGG - Intergenic
918786308 1:188768929-188768951 ACCTGGAACTCCAGTGAGGCAGG + Intergenic
919857568 1:201716173-201716195 GCGGGGATCTCCAGGGAAGCTGG - Intronic
920095485 1:203483780-203483802 TCCTGGATCTCCAGCACAACAGG + Exonic
920715644 1:208337739-208337761 ACCTGCCTCTCAAGGGAAAATGG - Intergenic
921342074 1:214144314-214144336 AGCTGGAACTCAAGGGAGACGGG + Intergenic
922465370 1:225842806-225842828 GCCAGGCTCTCCAGGGAATCAGG - Intronic
923165600 1:231358641-231358663 ACCTGGATTTGCATGAAAACTGG + Intergenic
924878190 1:248128715-248128737 ACCTAGAACTCCAGTGCAACAGG + Intergenic
924894081 1:248316996-248317018 ACCTGGAACTCCAGTGTGACAGG - Intergenic
1063040477 10:2332558-2332580 ACATTGATCTTCAGGAAAACAGG - Intergenic
1063149856 10:3326497-3326519 AGATGGATCTCCAGGGCATCAGG - Intergenic
1063244181 10:4201648-4201670 ACCTGCCTCTCCAGGGACATGGG - Intergenic
1066996007 10:42563579-42563601 ACCTGGAATCCCAGGGTAACTGG + Intergenic
1067251986 10:44594247-44594269 ACCTGGAACTCCAATGAGACAGG + Intergenic
1068410455 10:56646959-56646981 ACCTGTAACTCCAGTGAGACAGG - Intergenic
1070698675 10:78582752-78582774 GCCTGGAACTCCAGGGACAGAGG + Intergenic
1072032996 10:91539169-91539191 CCCTGGTTTTCCAGGGAAACAGG - Intergenic
1072454668 10:95565202-95565224 ACCTGGGTCCACAGGGAAACGGG + Intergenic
1072467550 10:95680557-95680579 ACCTGGATCTCCAGGGAAACTGG + Exonic
1072807805 10:98435660-98435682 ACCTGCTTCTCCACGGAAAATGG - Exonic
1080658373 11:34275698-34275720 ACCTGGTAGCCCAGGGAAACTGG - Intronic
1081657484 11:44867125-44867147 ACCAGCATCTCCTGGGAACCTGG + Intronic
1081800407 11:45855099-45855121 ACCTGGATCACCAGGGGAAAGGG - Intronic
1084410044 11:69001652-69001674 ACCTGAGCCTCCAGGGCAACAGG + Intergenic
1084564301 11:69920612-69920634 ACCTGGACCTCCTGGGGGACTGG - Intergenic
1084963615 11:72731754-72731776 AGGTGGATTTCCAGGGAAGCTGG - Intronic
1085170079 11:74442245-74442267 AGCTGGACCTCCAGGACAACTGG - Intergenic
1085908870 11:80797917-80797939 ACCTGGAAGTCCAGAGAGACAGG + Intergenic
1086403365 11:86479287-86479309 AGCTGGAGAACCAGGGAAACTGG - Intronic
1087863501 11:103194208-103194230 GCATGTATCTCCAGAGAAACAGG - Intronic
1088560966 11:111115987-111116009 ACATGGCTCTCCAGGGAAAAGGG - Intergenic
1089334296 11:117712463-117712485 ACCTTTCTCTCCAGGGAAACCGG - Intronic
1089683685 11:120133588-120133610 ACCAAGGTCTCCAGGGAAAGTGG + Intronic
1091588464 12:1829148-1829170 ACCTTGATCTCCAGGGAGGTGGG + Intronic
1091931804 12:4402526-4402548 ACCTCCATCTCCAGTGAAACGGG + Intergenic
1092160857 12:6314794-6314816 AGCTGGAATTCCAGGGAAAAAGG - Intronic
1092198053 12:6561927-6561949 ACCTGGATCCCCTGGGCAAGTGG - Exonic
1092389127 12:8059922-8059944 ACTTGGCTCTCCAGGGACAGTGG - Exonic
1094473907 12:30826797-30826819 TCCTAGATCTCCAGGGACCCAGG - Intergenic
1095373189 12:41494856-41494878 ACCTGCTTCTCCTAGGAAACTGG + Intronic
1096510075 12:52122811-52122833 TCCTGGAGCTCCTGGGAAGCTGG - Intergenic
1096916364 12:55037676-55037698 GCCTGGATTCCCAGGGAAAGTGG + Intergenic
1099957023 12:89360871-89360893 ACCTGAATAATCAGGGAAACAGG - Intergenic
1102461328 12:113101642-113101664 ACCTGGAGCTCCAGAGACCCTGG - Intronic
1105256770 13:18748573-18748595 AGCTGGAGCTGCAGGGATACAGG + Intergenic
1105694563 13:22875035-22875057 AACTGGAACTCTAAGGAAACAGG + Intergenic
1106849812 13:33777807-33777829 ACCTGGCTGTGCAGGGAAATGGG - Intergenic
1110161746 13:72386797-72386819 TCCTGGCTATCCAGGAAAACAGG - Intergenic
1110337251 13:74346709-74346731 GCCTGGAACTCCAGTGAGACAGG + Intergenic
1110380491 13:74844814-74844836 AGCTGGAGAACCAGGGAAACTGG + Intergenic
1111123298 13:83880944-83880966 ACCTCGACCTCCGGGGTAACAGG - Exonic
1111396783 13:87675999-87676021 ACTTGGACCTCCGGGGGAACCGG + Exonic
1111997320 13:95177561-95177583 AAATGGATCTTCAGGGAAGCAGG + Intronic
1111998144 13:95184991-95185013 AAATGGATCTTCAGGGAAGCAGG + Intronic
1112175191 13:97015695-97015717 GCCTGGATATGCAGGGAAACTGG + Intergenic
1114437916 14:22723554-22723576 AGCTGGCTCTGCAGGGGAACAGG + Intergenic
1116774110 14:49160089-49160111 ACATGAATCCTCAGGGAAACCGG + Intergenic
1119266787 14:73267437-73267459 ATCTGGAGCTCCTGGGACACTGG - Intronic
1119846555 14:77834783-77834805 ACCTGGTTCTACAGGGTAAGTGG + Intronic
1120720083 14:87881113-87881135 AGCTGGGTCTTCAGGGAGACAGG - Intronic
1122284879 14:100644947-100644969 ACCAGGAGTTCCAGGAAAACAGG - Intergenic
1128533207 15:68469265-68469287 AGCTAGATTTCCAGGGAGACAGG + Intergenic
1129153218 15:73702251-73702273 ACCTGGACCTCCAGGGCTCCTGG - Exonic
1129480351 15:75820162-75820184 ACCTGTACCTCCAGGGACCCAGG - Intergenic
1129798034 15:78392771-78392793 AAGTAGATCTCCATGGAAACTGG - Intergenic
1130509150 15:84574051-84574073 ACCTGTACCTCCAGGGACCCAGG + Intergenic
1130762143 15:86831902-86831924 ACCTGGATATCCAGGCAGAGGGG - Intronic
1133036515 16:3036766-3036788 ACCGGGATCGCCGGGGAACCGGG - Intronic
1133259182 16:4537716-4537738 ACCTGGGGCTCTTGGGAAACGGG - Intronic
1134174272 16:11993245-11993267 CCCTGGAGCTCCAGGTAAACTGG - Intronic
1134418997 16:14069402-14069424 AACTGGAAAGCCAGGGAAACTGG - Intergenic
1136069100 16:27777595-27777617 ACCAGGAGCTGCAGGGACACGGG - Exonic
1136168430 16:28472161-28472183 ACCTTGACCTCCAGAGATACTGG - Intergenic
1137520563 16:49191590-49191612 AACTGGGTCTCCAGGGAAAGGGG + Intergenic
1138657680 16:58500427-58500449 AACAGGATCACCAGGGAACCTGG - Intronic
1139682113 16:68573144-68573166 ACCTGGAGCTCCTGGGAAGGAGG + Intronic
1141133908 16:81453467-81453489 TCCTGGACCTCTAAGGAAACTGG - Intronic
1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG + Intergenic
1142990893 17:3730125-3730147 ACCTGGCTCCCCAGGGTCACTGG + Intronic
1143141415 17:4743776-4743798 ACCAGCTTCTCCAGGGAGACGGG + Exonic
1143619742 17:8074026-8074048 AGCGGCATCCCCAGGGAAACTGG - Intronic
1143793748 17:9319606-9319628 ATCTTGGTCTCCAGGGAAAAAGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144794023 17:17878909-17878931 ACCTGGCTGCCCTGGGAAACAGG + Intronic
1145785409 17:27590719-27590741 CCATGGAGCTCCAGGGCAACTGG - Intronic
1145873227 17:28294065-28294087 ACCTCCATCTCCATGGTAACAGG - Intergenic
1146302346 17:31699316-31699338 ACCTGGATCTCCATGAAGAAAGG + Intergenic
1146470005 17:33116618-33116640 ACCTGGATCTCCAGGAATGGTGG + Intronic
1147785984 17:42979319-42979341 ACCGGGCTGCCCAGGGAAACTGG - Intronic
1148587906 17:48794024-48794046 ACCTGGAGCCCAAGGGAGACAGG + Intronic
1149510551 17:57237545-57237567 AGCTGGACCTTCAGGGAAGCAGG - Intergenic
1150240276 17:63625956-63625978 ACCTCGGTCTCCTGGGTAACTGG - Intronic
1150280689 17:63928298-63928320 CCTTGGTTCTCCAGGCAAACTGG - Intergenic
1152775344 17:82198052-82198074 TCAGGGTTCTCCAGGGAAACAGG - Intronic
1153614519 18:6921849-6921871 ATCAGGAGCTCCAGGGAAGCTGG + Intergenic
1154428883 18:14293325-14293347 AGCTGGAGCTGCAGGGATACAGG - Intergenic
1156084534 18:33382797-33382819 ACCTGGAACTCCAGTGAGACAGG + Intronic
1156230786 18:35152221-35152243 ACCTAGAACTCCAGTGAGACAGG - Intergenic
1159391891 18:67804212-67804234 CCCTGCATCTCCAGTGAAAAGGG - Intergenic
1160021142 18:75182880-75182902 ACCTGGATACCCTGGGAAAGGGG - Intergenic
1160082394 18:75740826-75740848 ACATGGATCTCAAAGGACACAGG + Intergenic
1160612108 18:80096621-80096643 CTGTGGATCACCAGGGAAACTGG + Exonic
1161311397 19:3595997-3596019 CCCTGGATCTCAAGGGACCCCGG - Intronic
1161363841 19:3867664-3867686 ACCTGGGTTTCCAGGGAACTGGG - Intronic
1161754939 19:6125793-6125815 ACCTGGATCCACAGTGACACAGG + Intronic
1162322098 19:9976584-9976606 ACCTGGACAACCAGGGATACGGG - Exonic
1163379148 19:16952893-16952915 ACATGGATCTCAAGGGATCCTGG + Intronic
1164845267 19:31427033-31427055 AACTGGATCTTCAGAGATACCGG + Intergenic
1165329630 19:35134417-35134439 TGCCGGGTCTCCAGGGAAACAGG - Intronic
1166866637 19:45842381-45842403 GCCTGGAACTCCAAGGAAGCCGG + Exonic
1168062241 19:53899277-53899299 ACCAAGCTCCCCAGGGAAACAGG - Intronic
1168103899 19:54155391-54155413 ACCGGGACCTCCAGTGACACCGG + Exonic
1168161742 19:54514929-54514951 ACCCGAATCCCCAAGGAAACAGG - Intergenic
926305173 2:11632928-11632950 ACCTGGAGCTCGAGCGGAACCGG + Exonic
926475396 2:13315041-13315063 ACCTGGAACTCCAGTGAGACAGG - Intergenic
927847838 2:26480469-26480491 GCCTGGATATCCATGGAAGCAGG + Intronic
928880137 2:36088509-36088531 GCCTGGAACTCCAGAGATACAGG + Intergenic
930951303 2:57146690-57146712 ACCTGGAACTCCAGTGAGGCAGG + Intergenic
931303423 2:61003657-61003679 ACCTTGGTCTCCAGGGTAGCTGG + Intronic
932247831 2:70211321-70211343 ATCGGGAACTCCAGGAAAACAGG + Exonic
933632618 2:84674354-84674376 ACCTGGATTTCCCAGGGAACTGG - Intronic
933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG + Exonic
934853202 2:97713960-97713982 AGGTGGATGTCCAGGCAAACAGG - Exonic
934972189 2:98772814-98772836 TCCTGGATCCCCAGGGGTACGGG + Intergenic
935197954 2:100831410-100831432 ATCTTGATCTCCAGGGAATTAGG - Intronic
935631643 2:105217009-105217031 TCAAGGTTCTCCAGGGAAACAGG + Intergenic
936024736 2:109022404-109022426 ACCTGGATCCCCAAGAACACTGG - Intergenic
936502138 2:113074770-113074792 CCCTGGATCCCCAGGAAAATGGG - Exonic
938880476 2:135581271-135581293 CTGTGGATCTACAGGGAAACAGG - Intronic
940487744 2:154317678-154317700 ACCAGGAGTCCCAGGGAAACAGG - Intronic
940616445 2:156054636-156054658 CAGAGGATCTCCAGGGAAACTGG - Intergenic
941463927 2:165802677-165802699 AGCTGCATCTCCAGTGAAACAGG + Intergenic
941567067 2:167122539-167122561 ACTTGGATGTCCAGGCAATCTGG + Intronic
942248007 2:174025173-174025195 ACAGGGATCTCCAGGGAAGGTGG + Intergenic
943843640 2:192612389-192612411 ACATGGATCACCAGGGCACCAGG - Intergenic
944153985 2:196592625-196592647 GTTTGGTTCTCCAGGGAAACTGG - Intronic
944303946 2:198157752-198157774 TCCTGGATGTCCAGGAAAAATGG - Intronic
945262267 2:207854681-207854703 ACCTGGAATTCCAGGAAAGCTGG + Intronic
945909017 2:215625324-215625346 ATCTGGGGTTCCAGGGAAACTGG - Intergenic
946712236 2:222517882-222517904 ACCTGGATGGCCAGAGAACCTGG - Intronic
946726527 2:222666821-222666843 GCCTGGATCTTCTTGGAAACTGG + Intergenic
946786194 2:223246610-223246632 ACCTGGATCCCCAGGGATCCTGG + Intergenic
946891194 2:224278838-224278860 CTCAGAATCTCCAGGGAAACAGG - Intergenic
947028195 2:225762699-225762721 AGCTGGAGCACCAGGGAAGCTGG - Intergenic
947311601 2:228809352-228809374 GCCTGGAACTCCAGTGAGACAGG - Intergenic
947474927 2:230436013-230436035 ACCTGGAACCCCATTGAAACTGG - Intronic
947538118 2:230953763-230953785 AGCAGGATCTCCTAGGAAACTGG + Intronic
1169669219 20:8076519-8076541 CTCTGGATCTCCTGGGAAGCAGG - Intergenic
1170317712 20:15060694-15060716 ACTTTGATGTCCAGAGAAACTGG - Intronic
1170490656 20:16870632-16870654 AGCTGGAGAACCAGGGAAACCGG + Intergenic
1170607580 20:17885454-17885476 ATCTGCATCTCCAGGGACCCTGG - Intergenic
1171230302 20:23479072-23479094 ACCTGGATCTCGAGGGTCTCAGG - Intergenic
1172138236 20:32702570-32702592 TCCTGGGTCTCCAGTGAAATTGG - Intergenic
1172176782 20:32977325-32977347 CCCTGGATCCACAGGGAAAGAGG - Intergenic
1172212987 20:33214038-33214060 CCCTTGCTCTCCTGGGAAACTGG - Intergenic
1172872601 20:38144969-38144991 ACCTGGATCCCCAGGCTCACCGG - Intronic
1176849096 21:13899118-13899140 AGCTGGATCTGCAGGGATGCAGG + Intergenic
1177923317 21:27182482-27182504 ACCTGGAGAACCAGGAAAACTGG + Intergenic
1179180791 21:39043235-39043257 TTAGGGATCTCCAGGGAAACAGG - Intergenic
1181041935 22:20196419-20196441 ACCTGCGTCTCCAGGGGAGCTGG + Intergenic
1183539698 22:38422958-38422980 CCCTGGCTCTGCAGGGAAGCTGG + Intergenic
949426997 3:3928508-3928530 ACCTGGAGAACCAGGGAAACTGG + Intronic
950832231 3:15886203-15886225 AGCTGGATACCCAGGGAAACTGG - Intergenic
951077374 3:18412186-18412208 ACTTTAATCTCCAGGGACACTGG + Intronic
951823602 3:26842384-26842406 ACCTGAGTCTGCAGGGAACCTGG + Intergenic
954705469 3:52478251-52478273 ACCTGGATCTCCGGGACAACAGG + Exonic
957511425 3:81193273-81193295 ACCTGAATCTCCATAGGAACTGG + Intergenic
957821942 3:85388052-85388074 AACTGGCTCTCCAGGGAACCAGG + Intronic
960172736 3:114481797-114481819 GCCTGGGTCACCAGGGAAGCTGG + Intronic
960845634 3:122002023-122002045 ACCTCGGTCTCCAGAGAAGCTGG - Intronic
961264511 3:125630970-125630992 ACCTTGACCTCCAGGGTATCTGG - Intergenic
961936405 3:130589161-130589183 TCCTGGACCACCAGGGAAAAGGG + Exonic
962419034 3:135211392-135211414 ACCTGGATCTTCAGGAATAAAGG - Intronic
967395375 3:189002638-189002660 ACATGGAGCTCCAGGGAGAATGG - Intronic
968284891 3:197502721-197502743 ACATGAATCTCCTGGGAAACTGG - Intergenic
970185398 4:13446383-13446405 ACCTGGAACTCCAGTGAGACAGG - Intronic
971952183 4:33366483-33366505 ACATGGATATCCAGATAAACTGG - Intergenic
974026330 4:56736638-56736660 ACCTGAGTTTCCAGGCAAACTGG + Intergenic
974814728 4:66989535-66989557 ACCTGGATCTCCAGTGAGACAGG - Intergenic
975213000 4:71722703-71722725 ATCTGGAACTCCAGTGAGACAGG - Intergenic
976005647 4:80426611-80426633 ACCAGAATCTCCAGGGAGAGGGG + Intronic
977783402 4:101005713-101005735 AGCTGGATCTTCTGGGATACAGG - Intergenic
977860684 4:101956295-101956317 TCCTGTATTTCCATGGAAACCGG + Intronic
980177607 4:129365842-129365864 ACCTGGATTCCCAGGGATGCTGG - Intergenic
980855199 4:138431548-138431570 ACCTGGAACTCCAGTGAGACAGG + Intergenic
981057705 4:140382779-140382801 TCCAGTATCTCCAGGGAAAAAGG + Exonic
982848125 4:160276672-160276694 ACCTGGAACTCCAATGAGACAGG + Intergenic
983252229 4:165358065-165358087 ACCTGTATCTCCATATAAACTGG + Intergenic
984571948 4:181404852-181404874 AACTGGAGCGCCTGGGAAACAGG + Intergenic
985957704 5:3277098-3277120 ACGTGGAACTCCAGGGATCCAGG + Intergenic
986836805 5:11647867-11647889 ACCTGGATTTCTAAGGAAACAGG - Intronic
987207319 5:15640922-15640944 ACCTGCATCACCAGGGTAAGAGG + Intronic
988174362 5:27702320-27702342 ACCTCAGTCTCCAGAGAAACTGG + Intergenic
988326374 5:29773886-29773908 ACTTTGATCTCCAGGAAAATAGG - Intergenic
989425191 5:41288711-41288733 ACCTGGGCCTCCAGGTTAACTGG - Intergenic
989568611 5:42924983-42925005 ACCTGGTGCTCCAGGTAGACAGG - Intergenic
991262336 5:64680536-64680558 ACCTGGAGGCCCAGGGAAGCGGG + Intergenic
992199377 5:74368716-74368738 ATTAGGATTTCCAGGGAAACTGG + Intergenic
994473150 5:100235519-100235541 ACCTAGATATACAGGTAAACAGG - Intergenic
996530804 5:124524954-124524976 ACCTGGAGATCCACGGAAACTGG - Intergenic
996592239 5:125160813-125160835 ACCCGGAACTCCAGTGAGACAGG + Intergenic
996900976 5:128540880-128540902 ACCAGGAGCTCCAGGAAAATGGG + Intronic
997619205 5:135273807-135273829 GGCTGGAGGTCCAGGGAAACAGG - Intronic
998026513 5:138820559-138820581 ACCAGGATCACCCGGGAACCAGG - Intronic
998644581 5:144048196-144048218 GCCTGGAACTCCAGTGAGACAGG + Intergenic
998926064 5:147127710-147127732 ACCTGGATGTCCAGGCAGAAGGG - Intergenic
999143247 5:149376734-149376756 ACCTGTAGCCCCAGGGAGACAGG + Exonic
1001702977 5:173720958-173720980 TCCTCCATCTCCAGGGAAGCAGG - Intergenic
1002093081 5:176816239-176816261 ACCTGGCTCTCCAGCGATGCAGG - Intronic
1002137612 5:177117531-177117553 ACCTCGGCCTCCAGGGTAACTGG - Intergenic
1002452546 5:179327108-179327130 TCCTGGTTCTCAAGAGAAACTGG + Intronic
1002539632 5:179897801-179897823 ACCTCTATCTCCAGGAAAACAGG - Intronic
1004698659 6:18058007-18058029 GAGTGGATCTCCATGGAAACAGG - Intergenic
1005399991 6:25422172-25422194 ACCTGCATATCCAGGAAAATGGG + Intronic
1009313755 6:62190975-62190997 ATATGGATTTTCAGGGAAACTGG - Intronic
1009821247 6:68804030-68804052 ACCTTGAGCTCCTAGGAAACAGG - Intronic
1010213462 6:73381639-73381661 GCCTGAATGTCCAGGGAAAGAGG + Intronic
1012343506 6:98157168-98157190 GCCTGGAACTCCAGGGAGATAGG - Intergenic
1012974296 6:105763512-105763534 ACCTGGGTCTTCAGGGGAAGTGG - Intergenic
1018610670 6:165644887-165644909 ACGTTGATCTCCAGGAAATCTGG + Intronic
1019646356 7:2131439-2131461 CCCTGGCTCTCTAAGGAAACAGG + Intronic
1020365957 7:7380781-7380803 GCCTGGATCTCCAGGAAAACAGG - Exonic
1020557663 7:9690915-9690937 ACCTGGAACTCCAGTGAAATGGG + Intergenic
1022157980 7:27679414-27679436 ATGTTGATCTCCAGGCAAACTGG + Intergenic
1025100302 7:56129174-56129196 ACCCTGATCTCTAGGGAAGCAGG + Intergenic
1026685309 7:72504629-72504651 ACCTGGAAATACAGGGAAAAAGG + Intergenic
1029507217 7:100969608-100969630 ACCAGCATCTCCCGGGGAACGGG - Exonic
1032303666 7:130712919-130712941 TCCTGGTTCTCCAGAGAAAAAGG - Intergenic
1034075467 7:148227032-148227054 AACAGGATCACCATGGAAACAGG + Intronic
1037275161 8:17170603-17170625 TTCTGCATCTCCAAGGAAACAGG - Intronic
1037927188 8:22852900-22852922 TCCTGGCACTCCAGGAAAACTGG + Intronic
1038428063 8:27477964-27477986 ACCTTGACCTCCACGGAACCAGG - Intronic
1041230123 8:55741754-55741776 ACCTGAAACTCCAGTAAAACTGG - Intronic
1041481940 8:58331863-58331885 GCCTGGAACGCCAAGGAAACAGG + Intergenic
1043531407 8:81155063-81155085 AAATGAATCTCCAGTGAAACTGG - Intergenic
1043722178 8:83558589-83558611 ACCAGGAGCTCCAGGGTAAATGG - Intergenic
1044834627 8:96283716-96283738 CCCAGGAGCTCCAGGGAAAGAGG - Intronic
1046240619 8:111486194-111486216 AGCTGGGTCTCCAGGGCTACAGG - Intergenic
1048908941 8:139115862-139115884 AGCTGGCTCTACAGGGAAAAAGG + Intergenic
1048924073 8:139254904-139254926 AACTGCATCTCCAGGGATACGGG - Intergenic
1049224158 8:141441689-141441711 ACCTGGAGCTGCAGGGATCCTGG - Intergenic
1049453646 8:142676107-142676129 GACAGGATCTCCAGGGAACCCGG + Intronic
1051162332 9:14222420-14222442 ACCTCAAGCTCCAGGTAAACTGG + Intronic
1051185540 9:14457212-14457234 AACTGGATATCCAGGGAACAGGG + Intergenic
1051298146 9:15618534-15618556 ACCTGGAACTCCAGTGAGAAAGG - Intronic
1051533335 9:18129858-18129880 CCCTTGTTCCCCAGGGAAACAGG + Intergenic
1053498230 9:38564005-38564027 AGCCGGATCTGCAGGGATACAGG + Intronic
1055264387 9:74478079-74478101 ACCTGGAACTCCTGGGCAATAGG - Intergenic
1056186553 9:84140613-84140635 ACCTGGCTCCCCAGGCAAAGCGG + Intergenic
1056496442 9:87160076-87160098 CCCTGAATCACCAGGGACACTGG + Intergenic
1056814379 9:89791148-89791170 ACCTGGACCTCCAAAGAAGCTGG - Intergenic
1057073470 9:92120777-92120799 ATAGGGCTCTCCAGGGAAACAGG + Intergenic
1057219354 9:93247702-93247724 ACCTGGACCTGCAGGGGCACCGG - Exonic
1057311901 9:93948211-93948233 CCCTGGAGCTCCAGGGAGATGGG + Intergenic
1057511882 9:95687240-95687262 ACCTGGAGCTCCTAGGAAGCAGG + Intergenic
1057815595 9:98291708-98291730 AGCAGGGTTTCCAGGGAAACTGG - Intronic
1057913034 9:99035037-99035059 ACCTGGACCCCCGGGGAAAAAGG + Exonic
1060551536 9:124487761-124487783 AGCTGGGGCTCCAGGGAAACTGG - Intronic
1185742660 X:2546340-2546362 AGCTGGAGAACCAGGGAAACGGG + Intergenic
1185745731 X:2572058-2572080 CCCATGATCTCCAGGGACACCGG + Intergenic
1186616452 X:11193439-11193461 ACATGGATATCCTGGGAACCAGG - Intronic
1186872500 X:13786308-13786330 CCCTGGACCTCCGGGGCAACTGG + Intronic
1188915486 X:35904893-35904915 GCCTGGAACTCCAGCGAGACAGG - Intergenic
1189193429 X:39131817-39131839 GCCTTGATCTAGAGGGAAACCGG + Intergenic
1189731308 X:44023692-44023714 CCCTGGATCTCCAAAGAAAAAGG - Intergenic
1191766759 X:64706098-64706120 ACCTGGAACTCTAGGGAGACAGG - Intergenic
1192155949 X:68746795-68746817 CACTGGAACTCCAAGGAAACTGG + Intergenic
1194708097 X:97200317-97200339 GCCTGGAACACCAGCGAAACAGG + Intronic
1195023152 X:100849395-100849417 TACTGGATCTGCAGGGAGACAGG - Exonic
1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG + Intronic
1195321657 X:103726142-103726164 ACATGGATCTACTGGGAAAGAGG - Intronic
1195435948 X:104843420-104843442 ACCTGGAACTCCAGCGAGACAGG - Intronic
1197319073 X:125005992-125006014 TCCTGGAACTCCAGTGAGACAGG + Intergenic
1197923312 X:131619544-131619566 GCCTGGATCTCAAGGTAAAATGG - Intergenic
1199801185 X:151252842-151252864 ACCTGGAACTCCAGTGAGACAGG + Intergenic
1200169139 X:154059623-154059645 CCCTGGATCTCCAAGGGAATGGG - Intronic