ID: 1072470245

View in Genome Browser
Species Human (GRCh38)
Location 10:95706877-95706899
Sequence ACCCGGGCCATGAATGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072470245_1072470250 -2 Left 1072470245 10:95706877-95706899 CCGCCGCCATTCATGGCCCGGGT No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470245_1072470256 13 Left 1072470245 10:95706877-95706899 CCGCCGCCATTCATGGCCCGGGT No data
Right 1072470256 10:95706913-95706935 CCACTTGGAGAGATCCGAGCAGG No data
1072470245_1072470258 20 Left 1072470245 10:95706877-95706899 CCGCCGCCATTCATGGCCCGGGT No data
Right 1072470258 10:95706920-95706942 GAGAGATCCGAGCAGGCGCCGGG No data
1072470245_1072470257 19 Left 1072470245 10:95706877-95706899 CCGCCGCCATTCATGGCCCGGGT No data
Right 1072470257 10:95706919-95706941 GGAGAGATCCGAGCAGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072470245 Original CRISPR ACCCGGGCCATGAATGGCGG CGG (reversed) Intergenic