ID: 1072470250

View in Genome Browser
Species Human (GRCh38)
Location 10:95706898-95706920
Sequence GTGTTCAGCCCAACCCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072470239_1072470250 17 Left 1072470239 10:95706858-95706880 CCAGCAACCTGTCTGCCTTCCGC No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470240_1072470250 10 Left 1072470240 10:95706865-95706887 CCTGTCTGCCTTCCGCCGCCATT No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470247_1072470250 -8 Left 1072470247 10:95706883-95706905 CCATTCATGGCCCGGGTGTTCAG No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470237_1072470250 25 Left 1072470237 10:95706850-95706872 CCTTCTGCCCAGCAACCTGTCTG No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470246_1072470250 -5 Left 1072470246 10:95706880-95706902 CCGCCATTCATGGCCCGGGTGTT No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470242_1072470250 2 Left 1072470242 10:95706873-95706895 CCTTCCGCCGCCATTCATGGCCC No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470245_1072470250 -2 Left 1072470245 10:95706877-95706899 CCGCCGCCATTCATGGCCCGGGT No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470234_1072470250 28 Left 1072470234 10:95706847-95706869 CCCCCTTCTGCCCAGCAACCTGT No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470235_1072470250 27 Left 1072470235 10:95706848-95706870 CCCCTTCTGCCCAGCAACCTGTC No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470238_1072470250 18 Left 1072470238 10:95706857-95706879 CCCAGCAACCTGTCTGCCTTCCG No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data
1072470236_1072470250 26 Left 1072470236 10:95706849-95706871 CCCTTCTGCCCAGCAACCTGTCT No data
Right 1072470250 10:95706898-95706920 GTGTTCAGCCCAACCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072470250 Original CRISPR GTGTTCAGCCCAACCCCACT TGG Intergenic