ID: 1072470257

View in Genome Browser
Species Human (GRCh38)
Location 10:95706919-95706941
Sequence GGAGAGATCCGAGCAGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072470242_1072470257 23 Left 1072470242 10:95706873-95706895 CCTTCCGCCGCCATTCATGGCCC No data
Right 1072470257 10:95706919-95706941 GGAGAGATCCGAGCAGGCGCCGG No data
1072470247_1072470257 13 Left 1072470247 10:95706883-95706905 CCATTCATGGCCCGGGTGTTCAG No data
Right 1072470257 10:95706919-95706941 GGAGAGATCCGAGCAGGCGCCGG No data
1072470245_1072470257 19 Left 1072470245 10:95706877-95706899 CCGCCGCCATTCATGGCCCGGGT No data
Right 1072470257 10:95706919-95706941 GGAGAGATCCGAGCAGGCGCCGG No data
1072470251_1072470257 -10 Left 1072470251 10:95706906-95706928 CCCAACCCCACTTGGAGAGATCC No data
Right 1072470257 10:95706919-95706941 GGAGAGATCCGAGCAGGCGCCGG No data
1072470249_1072470257 2 Left 1072470249 10:95706894-95706916 CCGGGTGTTCAGCCCAACCCCAC No data
Right 1072470257 10:95706919-95706941 GGAGAGATCCGAGCAGGCGCCGG No data
1072470248_1072470257 3 Left 1072470248 10:95706893-95706915 CCCGGGTGTTCAGCCCAACCCCA No data
Right 1072470257 10:95706919-95706941 GGAGAGATCCGAGCAGGCGCCGG No data
1072470246_1072470257 16 Left 1072470246 10:95706880-95706902 CCGCCATTCATGGCCCGGGTGTT No data
Right 1072470257 10:95706919-95706941 GGAGAGATCCGAGCAGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072470257 Original CRISPR GGAGAGATCCGAGCAGGCGC CGG Intergenic