ID: 1072470258

View in Genome Browser
Species Human (GRCh38)
Location 10:95706920-95706942
Sequence GAGAGATCCGAGCAGGCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072470252_1072470258 -10 Left 1072470252 10:95706907-95706929 CCAACCCCACTTGGAGAGATCCG No data
Right 1072470258 10:95706920-95706942 GAGAGATCCGAGCAGGCGCCGGG No data
1072470249_1072470258 3 Left 1072470249 10:95706894-95706916 CCGGGTGTTCAGCCCAACCCCAC No data
Right 1072470258 10:95706920-95706942 GAGAGATCCGAGCAGGCGCCGGG No data
1072470248_1072470258 4 Left 1072470248 10:95706893-95706915 CCCGGGTGTTCAGCCCAACCCCA No data
Right 1072470258 10:95706920-95706942 GAGAGATCCGAGCAGGCGCCGGG No data
1072470245_1072470258 20 Left 1072470245 10:95706877-95706899 CCGCCGCCATTCATGGCCCGGGT No data
Right 1072470258 10:95706920-95706942 GAGAGATCCGAGCAGGCGCCGGG No data
1072470251_1072470258 -9 Left 1072470251 10:95706906-95706928 CCCAACCCCACTTGGAGAGATCC No data
Right 1072470258 10:95706920-95706942 GAGAGATCCGAGCAGGCGCCGGG No data
1072470247_1072470258 14 Left 1072470247 10:95706883-95706905 CCATTCATGGCCCGGGTGTTCAG No data
Right 1072470258 10:95706920-95706942 GAGAGATCCGAGCAGGCGCCGGG No data
1072470246_1072470258 17 Left 1072470246 10:95706880-95706902 CCGCCATTCATGGCCCGGGTGTT No data
Right 1072470258 10:95706920-95706942 GAGAGATCCGAGCAGGCGCCGGG No data
1072470242_1072470258 24 Left 1072470242 10:95706873-95706895 CCTTCCGCCGCCATTCATGGCCC No data
Right 1072470258 10:95706920-95706942 GAGAGATCCGAGCAGGCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072470258 Original CRISPR GAGAGATCCGAGCAGGCGCC GGG Intergenic