ID: 1072471769

View in Genome Browser
Species Human (GRCh38)
Location 10:95719982-95720004
Sequence AGCTGGGTATGGAGGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072471757_1072471769 28 Left 1072471757 10:95719931-95719953 CCACTCTGCTTCCTCTGGTATTT 0: 57
1: 121
2: 79
3: 63
4: 394
Right 1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG No data
1072471760_1072471769 17 Left 1072471760 10:95719942-95719964 CCTCTGGTATTTGGGAAAGCAGA 0: 59
1: 30
2: 19
3: 111
4: 255
Right 1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072471769 Original CRISPR AGCTGGGTATGGAGGGACAA TGG Intronic
No off target data available for this crispr