ID: 1072474757

View in Genome Browser
Species Human (GRCh38)
Location 10:95749639-95749661
Sequence TGTCCTCCCGAATATCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072474757_1072474761 19 Left 1072474757 10:95749639-95749661 CCATGTGGATATTCGGGAGGACA 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1072474761 10:95749681-95749703 CAGCATATGCAAAGACTTGGAGG No data
1072474757_1072474760 16 Left 1072474757 10:95749639-95749661 CCATGTGGATATTCGGGAGGACA 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1072474760 10:95749678-95749700 GAACAGCATATGCAAAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072474757 Original CRISPR TGTCCTCCCGAATATCCACA TGG (reversed) Intronic
902774265 1:18664589-18664611 TGTCATCCCTATTTTCCACATGG + Intronic
907483128 1:54758357-54758379 GGTCCTCTCCAATATCCACTGGG + Exonic
908845214 1:68317579-68317601 TGGGCTCCCGAATGACCACATGG - Intergenic
910496593 1:87835746-87835768 TGTACTCCCCAATACCCAAATGG + Intergenic
913381604 1:118217097-118217119 TGTCCTCCAGCATATCCCAATGG - Intergenic
923043260 1:230334675-230334697 TGTCCTCCAGCATGTCCACAGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1069854793 10:71434157-71434179 ATTCCTCCCAGATATCCACATGG + Intronic
1072474757 10:95749639-95749661 TGTCCTCCCGAATATCCACATGG - Intronic
1076270503 10:129148554-129148576 TGCCCTCCTGAATACCCACTCGG + Intergenic
1079028592 11:16968247-16968269 TCTCCTCCCAAACAACCACAAGG + Intronic
1079863137 11:25699664-25699686 TGTCCTCCCGCATCTCCCCTTGG + Intergenic
1082301842 11:50515494-50515516 TGAGCTCCCGAATATCCATTTGG + Intergenic
1084576404 11:69991351-69991373 TCTCCTCGTGAATGTCCACAGGG - Intergenic
1085258015 11:75187894-75187916 TGTCATCACCAGTATCCACATGG - Intronic
1086283656 11:85220336-85220358 TATTCTCCCAAATATCCACAAGG - Intronic
1087399276 11:97644092-97644114 TGTGCTCTCGTATATGCACATGG - Intergenic
1092574416 12:9764011-9764033 TGGCCTCCTGGATATCCACTGGG + Intergenic
1092712657 12:11353990-11354012 TGTCCTCCAGGAAATCCACAAGG - Exonic
1092716452 12:11393965-11393987 TGTTCTCCAGGAAATCCACAAGG - Exonic
1098345425 12:69497694-69497716 TTCTCTCCCGAATATCTACAGGG - Intronic
1104573090 12:129942474-129942496 GCTCCCCCCGGATATCCACATGG - Intergenic
1109343077 13:61086390-61086412 TGTCCTGCCTCATACCCACAAGG + Intergenic
1112803285 13:103135561-103135583 TGTCCTCCTGAAGTTCCACTTGG + Intergenic
1117485204 14:56189310-56189332 TGGCTTCCTGAATTTCCACAAGG - Intronic
1123962849 15:25424295-25424317 TCTTCCCCCAAATATCCACATGG + Intronic
1124552511 15:30694756-30694778 TGTCCTCCCAAGTATTCCCATGG - Intronic
1126711059 15:51456633-51456655 GGTGCTCCTGAATATCCTCAGGG - Intronic
1128395778 15:67223917-67223939 TCTTCTCCCAGATATCCACATGG + Intronic
1128992219 15:72270636-72270658 TTTCCACCCAGATATCCACATGG + Intronic
1130053411 15:80502765-80502787 TGCCCTCCAGAATACCCACTTGG - Intronic
1130871350 15:87974619-87974641 AGTCCTCCCCAATATCAAAAAGG + Intronic
1131817804 15:96240084-96240106 TCTCCTCCCTAAGATCCCCAAGG + Intergenic
1131916731 15:97274104-97274126 TCTCCACCAGAATATCCAGAGGG - Intergenic
1133437194 16:5790053-5790075 TGGAGTCCCGAATAACCACAAGG - Intergenic
1139391147 16:66606663-66606685 TGGCCTCCCCAACACCCACAGGG + Intronic
1203011775 16_KI270728v1_random:298910-298932 TGAGCTCCCAAATATCCAGATGG - Intergenic
1203030110 16_KI270728v1_random:572069-572091 TGAGCTCCCAAATATCCAGATGG - Intergenic
1203041611 16_KI270728v1_random:762362-762384 TGAGCTCCCAAATATCCAGATGG + Intergenic
1144825765 17:18104905-18104927 TGTCCTCCTGACTATCCAGGGGG - Intronic
1145800358 17:27679015-27679037 TGTCCACCCGTATACCCAGATGG - Intergenic
1147019499 17:37520306-37520328 TGACCTCCCCACTATGCACAGGG + Intronic
1152393631 17:80017978-80018000 TGTCCTTCCCAATAATCACATGG + Intronic
1155819619 18:30358859-30358881 TGTCTTCCTGAATAGCCACATGG - Intergenic
1159443067 18:68506669-68506691 TGTTCTCCAGGATATCCAGATGG + Intergenic
1159985823 18:74840116-74840138 TGTCCTCTTCAATATACACATGG + Intronic
1162068870 19:8141952-8141974 CTTCATCCCCAATATCCACACGG - Exonic
927494709 2:23544723-23544745 CATCCTCCCCACTATCCACACGG - Intronic
930767700 2:55101723-55101745 TATGCTCCAGGATATCCACAGGG - Intronic
931674719 2:64682931-64682953 TCTTCTCCCATATATCCACATGG + Intronic
935520186 2:104095127-104095149 TTTTCTCCCAGATATCCACATGG + Intergenic
940475626 2:154158699-154158721 GTTTCTCCTGAATATCCACATGG + Intronic
945965209 2:216179592-216179614 TCTCCTCCCAGATATCCACTAGG - Intronic
948305786 2:236945792-236945814 TTTCCTCCCCTATATCCCCAGGG - Intergenic
1172522361 20:35576324-35576346 TGTCCTCCTGAATCCCCACCTGG + Intergenic
1175144603 20:56886123-56886145 TTTCCTCCCAAATACCCACATGG - Intergenic
1175965618 20:62658732-62658754 TGCCCTGCTGAATATCTACACGG + Exonic
1176661169 21:9636260-9636282 TTTCCTACCGAATATTCACCTGG + Intergenic
1177316782 21:19472639-19472661 TGTTCTCCCCAAAATCCATATGG + Intergenic
1180357012 22:11851289-11851311 TATCCTTCCTAATATCCAGAGGG - Intergenic
1180381250 22:12141042-12141064 TATCCTTCCTAATATCCAGAGGG + Intergenic
1181319894 22:21996143-21996165 TCTTCTCCCAAATATCCTCATGG + Intergenic
1182924586 22:34110385-34110407 TGTCCTCCAGAGTGTCCAGAAGG - Intergenic
949291879 3:2476181-2476203 TGTCATCCACAATTTCCACAAGG - Intronic
953959977 3:47259226-47259248 TGTCCTCCCCACCATCCACAGGG + Intronic
963100011 3:141592258-141592280 TTTTATCCCAAATATCCACATGG - Intronic
964237032 3:154543647-154543669 TGCTCTCCTGAATATCCCCAAGG + Intergenic
968262580 3:197337046-197337068 TGCCCTCCCCAATCTCCACATGG - Intergenic
968878381 4:3286112-3286134 TGGCCTCACGAATAACCAGAAGG - Intergenic
974394954 4:61322604-61322626 TGTCCTGCCGGATTTTCACATGG - Intronic
975080312 4:70270239-70270261 TGTCCTGTAGAATATCCACATGG + Intergenic
977249957 4:94678759-94678781 CCTTCTCCCAAATATCCACATGG - Intergenic
977984818 4:103370697-103370719 TGTCCTACAGAATATTCAGAGGG - Intergenic
978610635 4:110534878-110534900 TGTCCACCCTATTATCAACAAGG + Intronic
981957203 4:150492809-150492831 TGTTCTCCCACATCTCCACATGG + Intronic
985330841 4:188830892-188830914 TGTCCTCTCAAACATGCACAGGG + Intergenic
985414223 4:189720268-189720290 TTTCCTACCGAATATTCACCTGG - Intergenic
989048902 5:37299245-37299267 TATTCTCCCGAATATTCACTTGG + Intronic
992381720 5:76243950-76243972 TGTTCTCTCAAACATCCACAGGG + Intronic
992409695 5:76493246-76493268 AGTCCTCATGAAGATCCACAGGG + Intronic
996284802 5:121776876-121776898 TCTTCTCCCAGATATCCACATGG + Intergenic
997289903 5:132722559-132722581 TGTCCTACCAGATATTCACATGG + Intronic
999604505 5:153299635-153299657 TTTCTTCCCGTATAACCACAGGG - Intergenic
1007328498 6:41083340-41083362 TGGCCTCTATAATATCCACATGG - Intronic
1015863342 6:137703117-137703139 AGTCCTCCCTAAAACCCACAAGG + Intergenic
1016398480 6:143652534-143652556 TGTACTCACAAATATCCACAAGG - Intronic
1018292749 6:162309553-162309575 TGTCTTGCCGAATAAGCACATGG + Intronic
1018831522 6:167447387-167447409 TGTATTCCTGGATATCCACAAGG - Intergenic
1019843053 7:3468615-3468637 TGTCCTCCCTTATACCCAGAAGG + Intronic
1036026869 8:4918426-4918448 TGTCCTTCTGTATATCCACCTGG + Intronic
1040576740 8:48658977-48658999 TGCCCTCCAGAATTTCCTCATGG - Intergenic
1042578686 8:70251892-70251914 TGTCATTCCCTATATCCACAGGG + Intronic
1044318059 8:90772451-90772473 TATTCTCACGATTATCCACATGG + Intronic
1049802547 8:144524786-144524808 CGTCCTCCCGCAGCTCCACACGG + Exonic
1052834600 9:33241106-33241128 TCTTCTCCCAGATATCCACATGG - Intronic
1054353738 9:64042692-64042714 TATCATTCCCAATATCCACAGGG - Intergenic
1055230339 9:74056133-74056155 TGTCCCCCTGAATTTCCAGATGG - Intergenic
1061466289 9:130782793-130782815 TGTCCTTCCCAACATCCTCAGGG - Intronic
1062422320 9:136488760-136488782 GGTCCTCCCGAGTGACCACAGGG - Intergenic
1203638737 Un_KI270750v1:138104-138126 TTTCCTACCGAATATTCACCTGG + Intergenic
1186536517 X:10355667-10355689 TCTCTTTCCAAATATCCACATGG - Intergenic
1188659349 X:32739250-32739272 TGTCCTCCCTACTGTTCACATGG + Intronic
1189344355 X:40229388-40229410 TGTCTTCCCAAATATGCACAAGG + Intergenic
1195427983 X:104756818-104756840 TCTTCCCCCAAATATCCACATGG - Intronic
1197626074 X:128803940-128803962 TGTCCTCCTGAATATCCTATTGG + Intergenic
1197757131 X:130003185-130003207 TTTTCTCCCAAATATCCACGTGG + Intronic
1198308827 X:135409335-135409357 TCTCCTCCAAAATATCAACAAGG + Intergenic
1200789996 Y:7291235-7291257 TGTCCTCCAGGTGATCCACATGG + Intergenic