ID: 1072475776

View in Genome Browser
Species Human (GRCh38)
Location 10:95758492-95758514
Sequence GGGGGCTAATCTAGACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072475776_1072475784 22 Left 1072475776 10:95758492-95758514 CCTTCAAGTCTAGATTAGCCCCC No data
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data
1072475776_1072475782 19 Left 1072475776 10:95758492-95758514 CCTTCAAGTCTAGATTAGCCCCC No data
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072475776 Original CRISPR GGGGGCTAATCTAGACTTGA AGG (reversed) Intronic