ID: 1072475776

View in Genome Browser
Species Human (GRCh38)
Location 10:95758492-95758514
Sequence GGGGGCTAATCTAGACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072475776_1072475782 19 Left 1072475776 10:95758492-95758514 CCTTCAAGTCTAGATTAGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data
1072475776_1072475784 22 Left 1072475776 10:95758492-95758514 CCTTCAAGTCTAGATTAGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072475776 Original CRISPR GGGGGCTAATCTAGACTTGA AGG (reversed) Intronic
902071930 1:13747689-13747711 GGGGCTTTATCTAGACTAGAAGG + Intronic
907870469 1:58438324-58438346 TGGGCCTAATCAAGTCTTGAGGG + Intronic
908198507 1:61769923-61769945 GGGAGATAACATAGACTTGAGGG - Intronic
910171948 1:84387102-84387124 GGCAGCTATTCCAGACTTGAAGG - Intronic
920028108 1:203016254-203016276 GGGGACTAATGTAAACTTCAGGG + Intronic
920509672 1:206541638-206541660 GGGGTCTAGGGTAGACTTGAAGG - Intronic
921899472 1:220435250-220435272 GAGGTCACATCTAGACTTGATGG + Intergenic
923407908 1:233680927-233680949 GGGGGCTTTTGAAGACTTGACGG + Intergenic
1065548474 10:26846185-26846207 GGTGGCTAGTCTAGAGGTGATGG - Intronic
1066129823 10:32381890-32381912 GGGGCTTAACCTAGGCTTGAAGG + Intergenic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1078092690 11:8277102-8277124 GAGGCCTAACCTAGTCTTGAGGG - Intergenic
1088175541 11:107049180-107049202 AGGTACTAATCTAGACCTGAGGG - Intergenic
1096031368 12:48418335-48418357 GGAGGCTAATGTTGGCTTGATGG + Intergenic
1099652116 12:85441966-85441988 GAGGGCTGATCTAGAGTTAAGGG + Intergenic
1107659847 13:42627411-42627433 GGGGGCTATACTAGTCGTGAGGG + Intergenic
1111028870 13:82570105-82570127 GGGGGCTCATCTGGATTTGTCGG - Intergenic
1126760442 15:51965128-51965150 GGGGGCAAATCTAGCGTGGATGG - Intronic
1136068380 16:27773806-27773828 GGGGGCTAAGGTAGACCAGAAGG - Intronic
1142314685 16:89336200-89336222 GTGGGCTACTCAAGACTTGAGGG + Intronic
1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG + Exonic
1146928154 17:36759116-36759138 GGGTGCTAATCTATTCATGAGGG - Intergenic
1151664910 17:75540305-75540327 GGGGGCTGGTCTAGACCTGGCGG - Intronic
1153969084 18:10208379-10208401 GGGAGCTAATCTAGTTCTGAAGG + Intergenic
1155917653 18:31572221-31572243 GAAGGATAATCTGGACTTGAAGG - Intergenic
1157432830 18:47643802-47643824 GGGTGCTAATCTATTCATGAGGG - Intergenic
1157923019 18:51733267-51733289 GTGGGCTGATACAGACTTGAGGG - Intergenic
1158736636 18:60090021-60090043 GGTGGCTAATCTGGTCTAGAAGG - Intergenic
1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG + Intergenic
1167323286 19:48809503-48809525 GGGGGCAGTTCTAGACGTGATGG - Intronic
925382761 2:3438302-3438324 GGGGGCTAATCCAGGGGTGATGG - Intronic
929597964 2:43187863-43187885 AGTGGCTATTCTAGACTGGATGG - Intergenic
931266032 2:60661119-60661141 GGGGGCAGATCTAGATTTGGGGG - Intergenic
932209046 2:69912316-69912338 GGAGTCTAAGCTAGACTTGTTGG + Intronic
938624632 2:133094897-133094919 GGGGGCTACTCTAAACTTCTAGG - Intronic
941810760 2:169754125-169754147 GGGGGTTAATCTATCCATGAGGG - Intronic
1172022647 20:31925242-31925264 GAGGGCAAATCTAGACTTTGGGG - Intronic
1173906595 20:46634237-46634259 GGGGGCTAATTCAGTCTTGAGGG + Intronic
1174566020 20:51465036-51465058 AGGTGCTAATCAATACTTGAAGG - Intronic
1175377200 20:58536288-58536310 GGTGGCTAATCTTTACTTAAAGG + Intergenic
949779404 3:7669249-7669271 TGGGCATAATTTAGACTTGAAGG + Intronic
950612160 3:14133617-14133639 CTGGGCTAATCTGGACTTGCAGG + Intronic
951416020 3:22422391-22422413 CAGGGCTCATCTAGACTGGAGGG + Intergenic
952683231 3:36120146-36120168 GGTGGGTTATCTATACTTGACGG - Intergenic
960533679 3:118793441-118793463 GGGGCCTGACCTAGACTGGAGGG - Intergenic
961615904 3:128180874-128180896 GGGGGCTAATGAAGTCCTGAAGG + Intronic
983420250 4:167507327-167507349 GGGAGCAAATCTAGCCTAGAGGG + Intergenic
986825823 5:11521223-11521245 GGGGGAGAATGTAGAATTGAAGG - Intronic
988117748 5:26919460-26919482 GGGGCCTAAAATAAACTTGAAGG + Intronic
991651054 5:68854042-68854064 GGGGCCTACTGTAGAGTTGATGG - Intergenic
998986139 5:147759601-147759623 GGTGGCTCCTCTAGACTGGATGG + Intronic
1012392475 6:98758065-98758087 GGGAACTAATCTAGTCTTGCTGG - Intergenic
1029565431 7:101333985-101334007 GTGGGCTAAGCTCCACTTGAGGG + Intergenic
1044514002 8:93117326-93117348 GGGCTCTAAGCTAGATTTGAAGG - Intergenic
1044519697 8:93185038-93185060 TTGGGCTAATCCAGAATTGAAGG + Intergenic
1055573113 9:77636730-77636752 GGGCACTAATCTATTCTTGAGGG + Intronic
1058222090 9:102314789-102314811 GGGAGCTAATTTAGTCATGAGGG + Intergenic