ID: 1072475778

View in Genome Browser
Species Human (GRCh38)
Location 10:95758510-95758532
Sequence TATAGAAGCATCCAAGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072475778_1072475782 1 Left 1072475778 10:95758510-95758532 CCCCCATCTTGGATGCTTCTATA 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data
1072475778_1072475784 4 Left 1072475778 10:95758510-95758532 CCCCCATCTTGGATGCTTCTATA 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072475778 Original CRISPR TATAGAAGCATCCAAGATGG GGG (reversed) Intronic
900837390 1:5015750-5015772 AATGGAAGCATCTAAAATGGTGG + Intergenic
901421963 1:9157209-9157231 TGTTGAAGCAACCAAGAAGGCGG + Intergenic
905396262 1:37668676-37668698 CATAGAAGTCCCCAAGATGGTGG - Intergenic
909173581 1:72325075-72325097 TATATATGCATCCAAGATTGTGG + Intergenic
909270042 1:73611876-73611898 TAGAGAAGCAGCAAAGATGAAGG - Intergenic
911967255 1:104384587-104384609 TAAAGAAGCATTAATGATGGAGG - Intergenic
911983225 1:104592351-104592373 AATAGATGCATTGAAGATGGTGG - Intergenic
913609982 1:120501586-120501608 TATAGAAGCTTCCTAGGTGATGG + Intergenic
914203827 1:145509552-145509574 TATAGAAGCTTCCTAGGTGATGG - Intergenic
914482950 1:148082706-148082728 TATAGAAGCTTCCTAGGTGATGG - Intergenic
914581206 1:149020655-149020677 TATAGAAGCTTCCTAGGTGATGG - Intronic
915710885 1:157896977-157896999 TATGAAAGCAGCCAAGAGGGAGG - Intronic
916159671 1:161896395-161896417 TGTATAATCATCCAATATGGAGG - Intronic
916666294 1:166970789-166970811 GAGAGAAGCATCCAGGCTGGGGG + Intronic
919291228 1:195633969-195633991 TTTAGAGGCATCCAAGTTTGTGG - Intergenic
919989766 1:202701790-202701812 TATAGCAGTAATCAAGATGGGGG - Intronic
920591333 1:207221613-207221635 TATTGTAGCATCAAAAATGGAGG + Intergenic
921716072 1:218418174-218418196 CATAAAAGCAGCCAAGAGGGGGG + Intronic
922760316 1:228125331-228125353 AAGACTAGCATCCAAGATGGAGG + Intergenic
1067837744 10:49652073-49652095 TCTAGAAGCATCCTGGAGGGAGG + Intronic
1072475778 10:95758510-95758532 TATAGAAGCATCCAAGATGGGGG - Intronic
1074693651 10:116028975-116028997 TGGAGAAGCATCCAAGAGGGAGG - Intergenic
1075003602 10:118815230-118815252 TAGAGAAGAATCCCATATGGAGG - Intergenic
1075014234 10:118898464-118898486 TAAAGAAGCATTAATGATGGAGG - Intergenic
1077963312 11:7098610-7098632 TATATAAGCATTCAAATTGGTGG + Intergenic
1078008617 11:7552012-7552034 GATAGAACCTTCCAAGATGGAGG - Intronic
1078078256 11:8180990-8181012 TGTAAGAGCATCCCAGATGGAGG - Intergenic
1079230846 11:18647498-18647520 TAAAGAGGCATCAATGATGGAGG - Intergenic
1080580070 11:33635047-33635069 TAGAGAAGCTTCCAGGATGCAGG + Intronic
1080928426 11:36782844-36782866 TATAGAAGGACCCAAAATTGGGG - Intergenic
1086043848 11:82509954-82509976 TATAGAAACATACAAGAGGCTGG - Intergenic
1088783412 11:113158562-113158584 TACAGGAGCAACAAAGATGGAGG - Intronic
1092090736 12:5801843-5801865 AGTAGAAGCACCCAAGATGTGGG - Intronic
1093146138 12:15569105-15569127 TTTAGAAGCAACACAGATGGGGG + Intronic
1094011203 12:25811740-25811762 TATAGAAGCAACCAGGAAGTTGG - Intergenic
1095596906 12:43969705-43969727 TTTAGAAACACCCAAGATGATGG - Intronic
1098713719 12:73801685-73801707 CATGAAAGCAGCCAAGATGGGGG + Intergenic
1102779211 12:115548975-115548997 CATCCAAGCAACCAAGATGGTGG - Intergenic
1106370597 13:29128920-29128942 TATAAAGGCATCAAAGATGAAGG - Intronic
1106646384 13:31638692-31638714 TACTGAAGAAGCCAAGATGGGGG + Intergenic
1108818962 13:54322140-54322162 TAAGGAAGCATCCAGCATGGGGG - Intergenic
1109823836 13:67692105-67692127 CATAAAAGCAGCCAAGAGGGAGG - Intergenic
1110636083 13:77768321-77768343 GCCAGAAGCATCCAACATGGAGG + Intergenic
1111521936 13:89416535-89416557 TACAGAAGCAGAAAAGATGGAGG + Intergenic
1111770052 13:92585222-92585244 CATGGAAACACCCAAGATGGAGG + Intronic
1112812471 13:103234325-103234347 CATAAAAGCAGCCAAGAGGGAGG + Intergenic
1113474274 13:110569127-110569149 TCTAGAAACGTTCAAGATGGCGG + Intergenic
1116528380 14:45935154-45935176 TATGAAGGCATCCAGGATGGGGG + Intergenic
1117531080 14:56661266-56661288 TATGGAAGCATCCACAATTGTGG - Intronic
1117632772 14:57710576-57710598 TATAAAAGCAACCAGGATGGGGG + Intronic
1117791276 14:59344531-59344553 TATAGAACCATCCCTGAGGGCGG + Intronic
1118155261 14:63234130-63234152 TAGAGAAGCTTTCAAGAAGGAGG - Intronic
1119674508 14:76543913-76543935 AATAGAGGCAGCCAAGCTGGAGG - Intergenic
1123151776 14:106188686-106188708 TTTGGAAGCATACATGATGGAGG - Intergenic
1124952742 15:34338214-34338236 TCTGGAAGCATCCTAGAGGGCGG + Intergenic
1125472052 15:40014213-40014235 CATGGAAGCATCCAGGAGGGAGG - Intronic
1125964342 15:43861377-43861399 TATAGAAGCCTACCTGATGGTGG - Exonic
1126453894 15:48840567-48840589 AATAGAAGGATCCATTATGGGGG + Intronic
1128344533 15:66845189-66845211 TAGAGCAGCAAACAAGATGGTGG + Intergenic
1130858374 15:87862457-87862479 TACAGAGGCATTCAAAATGGAGG + Intronic
1131903908 15:97119834-97119856 TATATAAGCATCCAACATCAGGG + Intergenic
1132122031 15:99184360-99184382 CATGGAAGCAGCCAAGAGGGGGG + Intronic
1132213109 15:100040716-100040738 TTAAGAAACATTCAAGATGGAGG - Intronic
1133001781 16:2855573-2855595 TGGGGGAGCATCCAAGATGGAGG - Exonic
1140862902 16:79034643-79034665 CACAGAAGCATTCAAGATGTTGG - Intronic
1143775773 17:9197927-9197949 CAGAGAAGCCTCCAAGAAGGTGG + Intronic
1143929957 17:10412076-10412098 TATAGAAGAAACTAAGATGCAGG - Intronic
1146932233 17:36785463-36785485 TAGAGAAGAATCCAGGGTGGGGG - Intergenic
1147844642 17:43396335-43396357 TAAAGAAGCTTCAAAGATTGTGG + Intergenic
1149052653 17:52325352-52325374 CATAAAAGCAGCCAGGATGGGGG - Intergenic
1153132633 18:1874341-1874363 TATAGAAACTTCAAAGAAGGAGG + Intergenic
1157874110 18:51255662-51255684 TAAAGGAGCATTCAAGGTGGAGG - Intergenic
1157978621 18:52354423-52354445 TTTAGAAGCAACTTAGATGGAGG + Intronic
1158061447 18:53348421-53348443 TATAAAAGCAGCCAGGAGGGAGG - Intronic
1158259324 18:55589902-55589924 TAGAGAGGCGGCCAAGATGGCGG + Intronic
1159089245 18:63828743-63828765 TATAGAAACATGCAAAATTGTGG - Intergenic
1160066507 18:75579817-75579839 TACAGAAGAATCCAAGACAGAGG + Intergenic
1162536452 19:11265316-11265338 TAGAGAAGCATCCAGGAGGCAGG - Intergenic
1163924416 19:20325988-20326010 TATAGACGCATCCAAAATCTTGG + Intergenic
1164202185 19:23028108-23028130 TAAAGAGGCATTAAAGATGGAGG + Intergenic
1164708301 19:30336477-30336499 TATAGAAGCTTACAGGCTGGCGG + Intronic
927767530 2:25826022-25826044 TATACAAGCATACAACGTGGTGG + Intronic
927948377 2:27150816-27150838 TCTAGAAGCAACCAAGCTGGGGG + Intronic
932917236 2:75872398-75872420 GCTAGCAGCTTCCAAGATGGTGG - Intergenic
933538541 2:83608907-83608929 TATAAAAGAATCTAAGATGTGGG + Intergenic
937738738 2:125322534-125322556 TATAGAAGAATTCAAAATGGAGG + Intergenic
937754931 2:125525624-125525646 TTTAAAAGAAACCAAGATGGAGG + Intergenic
939559231 2:143713888-143713910 TATGAAAGCAGCCAGGATGGAGG - Intronic
941614805 2:167707181-167707203 CAAAGAAGCACCCAAGATGATGG + Intergenic
943366287 2:186970411-186970433 CAGAAAAGCAACCAAGATGGTGG - Intergenic
944387743 2:199183619-199183641 TAAAGAGGCATTCATGATGGAGG - Intergenic
945576506 2:211536614-211536636 TATAGAACCAAAGAAGATGGAGG + Intronic
945693428 2:213071147-213071169 TATAAAAGAAACCAAGTTGGGGG + Intronic
947051304 2:226046328-226046350 TCTAGCAGCTTCCAAGATGCTGG - Intergenic
947329950 2:229018172-229018194 TATAGAAACATCTTAAATGGGGG - Intronic
947498469 2:230655870-230655892 TATAGCAGAGTCCAAGTTGGGGG - Intergenic
948922700 2:241073181-241073203 TATAGAAGCACTCAAAAGGGTGG + Intronic
1169442871 20:5647625-5647647 TTTAGAAGCAGCCAATCTGGAGG - Intergenic
1169461722 20:5801379-5801401 AATAGCAACATTCAAGATGGTGG - Intronic
1170278972 20:14624748-14624770 AATAGCTGCATCCAAGGTGGGGG + Intronic
1171055045 20:21898414-21898436 TATGAAAGCTACCAAGATGGAGG - Intergenic
1175557014 20:59871512-59871534 CAGAGTAGCATCAAAGATGGTGG + Intronic
1177085665 21:16700523-16700545 TAAAGAAGACTCCAAAATGGAGG - Intergenic
1181902423 22:26167869-26167891 TAAAGAAGCAAGGAAGATGGAGG - Intergenic
952438143 3:33293562-33293584 TACAGGAGCATTGAAGATGGGGG + Intronic
954328612 3:49877284-49877306 TATGGAAGCCACCAAGAAGGTGG - Intergenic
957896275 3:86424644-86424666 CATAAAAGCAGCCAAGAGGGGGG - Intergenic
964504920 3:157388641-157388663 TGTAGAACCCTCCAATATGGAGG - Intronic
965523897 3:169696749-169696771 TACAGAAGCATGACAGATGGTGG + Intergenic
967060450 3:185867768-185867790 TATAAAATCATCTCAGATGGTGG - Intergenic
973087440 4:46083333-46083355 TATAGCAGTATAGAAGATGGAGG - Intronic
975307396 4:72865654-72865676 TGTAAAAGCAGCCAGGATGGGGG + Intergenic
977030523 4:91876768-91876790 TATAAAAGCAGCCAGGAGGGGGG + Intergenic
978699515 4:111626116-111626138 TATATATGCATCCAATATAGGGG - Intergenic
980295152 4:130904631-130904653 TTTAGAAGCATCAAAGTTGGCGG + Intergenic
984085925 4:175311290-175311312 TATTCAAGCATCCAAAGTGGAGG - Intergenic
988415855 5:30946549-30946571 TAAAGAAGCTTCCAAGCAGGGGG + Intergenic
993575202 5:89591460-89591482 CATGAAAGCAGCCAAGATGGGGG + Intergenic
993753584 5:91700735-91700757 TGTTAAAGCATCCAAGAGGGAGG - Intergenic
996834633 5:127777147-127777169 TATAAAAGCAGCCATGAGGGAGG + Intergenic
996836028 5:127793350-127793372 TATAAAAGGAAGCAAGATGGTGG + Intergenic
1000587672 5:163120520-163120542 TATATATGCATCCAAGACAGGGG - Intergenic
1001088505 5:168719708-168719730 TAAAGAATCATCCAAAATGAGGG - Intronic
1002312593 5:178323668-178323690 TCTAGAAGCAGCCAAGGTGACGG - Intronic
1007304864 6:40895884-40895906 TATAGAGAGATCCAAAATGGAGG - Intergenic
1008623630 6:53296672-53296694 TATAGAATCTTAGAAGATGGAGG - Intronic
1010355512 6:74927951-74927973 TATAGAAGTATCCCAAAAGGTGG - Intergenic
1010752753 6:79632902-79632924 TATTGAAGCATGCAAGTCGGTGG - Intronic
1012488174 6:99745375-99745397 TATGGGAGAAGCCAAGATGGAGG + Intergenic
1016775621 6:147901684-147901706 TATCGAAGCTTCCAATATTGTGG - Intergenic
1017683305 6:156886002-156886024 TATTGGAGCATCCAAGATTTTGG + Intronic
1020608142 7:10363020-10363042 CATAGAAGCAACCAGGATGGGGG + Intergenic
1022336332 7:29425304-29425326 ATCAGCAGCATCCAAGATGGTGG + Intronic
1028836068 7:95376769-95376791 AAAGGAAGCTTCCAAGATGGCGG + Intronic
1031302579 7:120081450-120081472 TAAAGAAATATCAAAGATGGTGG + Intergenic
1032487898 7:132301904-132301926 TGATGAAGCAGCCAAGATGGAGG + Intronic
1034734541 7:153416340-153416362 TATAGAAGCTAAAAAGATGGTGG + Intergenic
1034984998 7:155506312-155506334 TAAACAAGCATCCAAGTTAGGGG + Intronic
1039666980 8:39544241-39544263 TGTGAAAGCAGCCAAGATGGGGG - Intergenic
1041719309 8:60961831-60961853 GGTAGGAGCCTCCAAGATGGTGG + Intergenic
1041894508 8:62908019-62908041 TATGAAAGCAGCCAGGATGGGGG + Intronic
1044113077 8:88300795-88300817 TACAGAAGCCTCCAAGATTGAGG + Intronic
1046309492 8:112415661-112415683 TATGAAAGCAGCCAGGATGGGGG + Intronic
1046859143 8:119070630-119070652 TAAAGAAACCACCAAGATGGGGG - Intronic
1047777504 8:128085228-128085250 TACATGTGCATCCAAGATGGCGG - Intergenic
1048217548 8:132510191-132510213 TGTGGAAGCAGCCAAGAGGGAGG - Intergenic
1051346063 9:16152219-16152241 TATAAATGCATCTAAGTTGGAGG - Intergenic
1054919986 9:70533264-70533286 TATAGAGGAATCCAAGAAGGAGG - Exonic
1058065598 9:100545021-100545043 CATGAAAGCAGCCAAGATGGAGG - Intronic
1059654094 9:116341503-116341525 TATAGAAGGATCCATGAGGAAGG - Intronic
1059853636 9:118370959-118370981 CATAGAATCATCCAAGCAGGTGG + Intergenic
1060920261 9:127415482-127415504 TAAAGAAGCATTAATGATGGAGG + Intergenic
1185622687 X:1463229-1463251 TACAGAAGCATCCAGGCTGCAGG - Exonic
1186679040 X:11852718-11852740 TATATAAGCATCCAACACAGGGG + Intergenic
1187615042 X:20983923-20983945 TATATATGCATCCAACATTGGGG + Intergenic
1189071435 X:37867661-37867683 TATATAAGCATCATATATGGCGG - Intronic
1190221854 X:48516994-48517016 TGCAGAGGCATCCAAGATGAGGG - Intronic
1193624334 X:83797599-83797621 TATATATGCACCCAACATGGGGG + Intergenic
1195282355 X:103348424-103348446 TATTTAAACATCCACGATGGTGG + Intergenic
1196041113 X:111205219-111205241 TATTGAAGGAGCCAAGAGGGAGG + Intronic
1196506936 X:116457888-116457910 TATAGAAGTAGCCAAGAGGAAGG - Intronic
1196522415 X:116689129-116689151 TATAGAAGTAGCCAAGAAGTAGG - Intergenic
1197026389 X:121755040-121755062 TATAGAAACTTACAAGAAGGTGG - Intergenic
1198309733 X:135419060-135419082 TAGAGAATCATCCAAGTTGTTGG - Intergenic
1200478104 Y:3666156-3666178 CATGAAAGCAGCCAAGATGGGGG + Intergenic
1201724539 Y:17138294-17138316 TAAAGAGGCATTAAAGATGGAGG + Intergenic
1202076200 Y:21040179-21040201 TAAAGAAGCATTAATGATGGAGG + Intergenic